Help please!!! ( No links aloud )


≤))✓
_| \_

Help Please!!! ( No Links Aloud ) ))_| \_

Answers

Answer 1

Answer:

i would say you can go to a link but no link T-T

Explanation:


Related Questions

In a sample of double stranded dna if 19% of the nitrogenous bases are guanine what percent of the nitrogenous bases are adenine

Answers

Answer:

31%

Explanation:

Chargaff's law says the amount of A (adenine) = T (thymine) and G (guanine) = C (cytosine). If

G = 19% then C= 19%

19% + 19% = 38%

100% - 38% = 62%

62% for A and T

Divide by 2 and you get

31%

What is science to you? like whats your own definition of science

Answers

Answer:

The study of anything basically. It is learing new things by observation, experiments, facts, principle, and hypothesis.

Answer:

it's the studying of scientific knowledge

Please help ASAP! I have about 30 questions more to answer, so It would be so helpful if you answered this question. Thank you!

What do agriculture and urbanization have in common?

Answers

Answer:

Agriculture and urbanization both have the goal of expanding human value of living.

Explanation:

Answer:

Explanation:

Basically both of them benefit each other .

Urbanization brings major changes in demand for agricultural products both from increases in urban populations and from changes in their diets and demands.  It can also bring major challenges for urban and rural food security.

Hope this helped !

In the presence of oxygen, _____ molecules of ATP can be formed during cellular respiration.

A. 36 to 38
B. 19 to 24
C. 2 to 4
D. 63 to 68
E. 38 to 42

Answers

the answer is A. 36 to 38. hope i helped!!

Can someone name and explain each lymph organ?

Answers

Answer:

The lymphatic system consists of all lymphatic vessels and lymphoid organs. For example, the lymph nodes, spleen, thymus as well as the lymphatic tissue found in the small intestine (Peyer’s patches) and throat (adenoid tonsils, palatine and tubal tonsils), to name a few, all represent lymphatic organs.Hence, rather than representing a single organ, the lymphatic system comprises a circulatory network of vessels and lymphoid tissue and cells in every part of the body. It works together closely with the blood-producing (haematopoietic) system in the bone marrow, thereby playing a vital role in immune responses to protect the body from various pathogens. Also, the lymphatic vessel network helps transporting nutrients and waste products in the body.

Answer:

please follow me

Explanation:

yr60zpzyoy9yit*fiif7rrr

Mary pushes her cart across the floor with a force of 150N for a distance of 10m. What is the work done on the cart?

Answers

Answer:

1500Joules

Explanation:

Work done, denoted by W, can be calculated using the formula:

Work done (W) = force (F) × distance covered (d)

According to the information in this question, Mary pushes her cart across the floor with a force (F) of 150N for a distance (d) of 10m.

Hence, work done (W) by the cart is:

W = 150N × 10m

W = 1500 Newton.metre (N.m) or Joules (J).

What is an example of victimology?

A victim's regular routine and mannerisms are analyzed.
A suspect's habits and food preferences are analyzed.
A list of victims is compiled and released to reporters.
A suspect's childhood history is analyzed.

Answers

Answer:

A

Explanation:

Criminal profilers use a method called victimology to understand more about the killer. By analyzing behavior, habits, and the temperament of the victim(s), the criminal profiler is able to construct a physiological profile of the person

what did humans evolve from I am creating a a evolution chain I know this can be considered a unintelligent question I am just not positive on what we evolved from

Answers

Answer: Human evolution, the process by which human beings developed on Earth from now-extinct primates. Viewed biologically, we humans are Hono Sapines, a culture-bearing upright-walking species that lives on the ground and very likely first evolved in Africa about 315,000 years ago.

Human evolution is not linear manner it is a web, in the process of evolution primates lead to the emergence of homo-sapiens, which is distinct from the hominid family.

How did humans evolve?

Human evolution is observed in a web manner not linear in evolutionary history primates lead to the homo-sapiens which is distinct from another family of hominids.

The hominid family includes great apes that diverged from the gibbons 15-20 million years ago. Evolution involves some studies, genetic studies, and h behavioral studies.

Anatomically it is observed in Africa 300000 years ago humans appeared, these studies were observed anatomically as the origin of humans.

Therefore human evolution is observed in a web manner not linear.

Learn more about human evolution, here:  

https://brainly.com/question/24276894

#SPJ2

helpppppppppppppppppp

Answers

I’ve tired I’m sorry I don’t know

Why does a mountain create a rain shadow on the other side of a mountain?

Answers

Answer:

I hope this will help u

Explanation:

A rain shadow is a dry region of land on the side of a mountain range that is protected from the prevailing winds. ... As the air rises up over a mountain range, the air cools, water vapor condenses, and clouds form. On this side of the mountains, called the windward side, precipitation falls in the form of rain or snow

Describe one method to reduce the air pollutants released from a coal burning power plant

Answers

Answer:

A method to reduce the air pollutants released from a coal burning power plant is carbon capture.

Explanation:

Carbon Capture: It separates CO2 from emissions sources and recovers it in a concentrated stream. The CO2 can then be injected into the soil underground for permanent storage, or sequestration. Reuse and recycling can also reduce the environmental effects of coal production and use.

For predation to occur, there must be a predator species and a prey species. Define predator and prey and give an example of each.

Answers

A predator is a carnivore animal that preys on prey animal. Prey animals are usually small herbivores or just smaller animals. Examples, lion and gazelle, bear and salmon, wolf and deer.

Shawn explains that many studies have shown that directly spraying bees with fungicides doesn't harm them. Are those results consistent with what Shawn has discovered? Explain your answer in a few sentences.

Answers

Answer:

Yes.

Explanation:

Yes, the results will be consistent of spraying bees with fungicides because the fungicides affect the growth of fungus not the bees. fungicides  are the chemicals kills fungal growth while on the other hand, insecticides will kill the insects such as ants, bees etc. If the Shawn apply insecticide on the bees, it will kill the bees due to its effectiveness so that's why the results of the directly spraying bees with fungicides will always be consistent due to its ineffectiveness.

What were the old women doing?
In Percy jackosn

Answers

Answer:

If it is the scene that I think you're referring to, they were sitting in a group on rocking chairs, cutting yarn.

Explanation:

in Greek mythology, these women are the three Fates, named Clotho, Lachesis, and Atropos. In mythology, a thread represented someone's lifeline, and when the Fates cut your thread, it meant your life was over and you died.

In this specific scene, from The Lightning Thief, the Fates are seen cutting a blue piece of yarn, which makes Percy's friend Grover nervous because he believes they've just cut Percy's lifeline.

Cytotoxic T cells protect the body by _____________.

A. secreting toxic substances that destroy pathogens

B. phagocytizing invaders

C. activating the complement system

D. making antibodies that float free in the body fluids

Answers

C.) Hope it helps :)

What might happen if the number of chromosomes within the cells did not change but new daughter cells were still made? (meiosis)

Answers

Answer:

No fertilization occurs.

Explanation:

No zygote is formed if the the number of chromosomes within the cells did not change or remain the same i.e. diploid because for the production of zygote, half number of chromosomes are required in both male and female sex cells or gametes. If the chromosomes are half in both gametes so they fuse with each other forming zygote having diploid cell so we can conclude that for the happening of fertilization process, half number of chromosomes in gametes is necessary if not, no fertilization occurs.

Plants produce oxygen which animals use. Animals produce carbon dioxide which plants use. Predict the most likely outcome if airborne pollution blocked the sun’s rays so significantly that the percentage of living plants was decreased by 95%.

A. Plants would quickly evolve to consume a mixture of oxygen and carbon dioxide

B. Animals would quickly evolve to begin using carbon dioxide

C. The atmosphere would fill with carbon dioxide, and animals would begin to die.

D. The atmosphere would fill with oxygen, and animals would begin to die.

Answers

Answer:

C

Explanation:

A can’t happen because there are barely any plants

B can’t happen because Animals need Oxygen to breathe

D won’t happen due to lack of plants

List 4 characteristics of Animals.

Answers

Answer:

animals

Explanation:

The Animal Kingdom

Animals are multicellular.

Animals are heterotrophic, obtaining their energy by consuming energy-releasing food substances.

Animals typically reproduce sexually.

Animals are made up of cells that do not have cell walls.

Animals are capable of motion in some stage of their lives.

PLSSS HELP WITH THIS IMMEDIATELY!!!!! only answer if u know, i’ll be giving brainiest to the right answert

Answers

Answer:

I cant see the question just use the snipping tool to tack a screenshot

Explanation:

Which list describes the organization within multicellular organisms from least complex to most complex?


A,proteins, organelles, cells, organisms
B,proteins, cells, organelles, organisms
C,cells, organelles, proteins, organisms
D,organelles, cells, proteins, organisms
d

Answers

Answer: A (proteins, organelles, cells, organisms)

Cells, organelles, proteins, organisms describes the organization within multicellular organisms from least complex to most complex. The correct option is C.

What are multicellular organisms?

Multicellular organisms include a mixture of more than one cell, with differentiating groups of cells performing specialized functions.

Early stages of development, cells in humans distinguish towards becoming nerve cells, skin cells, muscle cells, blood cells, as well as other types of cells.

All animals, land plants, and most fungi are multicellular, as are numerous algae, with the exception of slime molds and social amoebae such as the genus Dictyostelium, which are partially unicellular and partially multicellular.

Cells, organelles, proteins, and organisms describe the organization of multicellular organisms in descending order of complexity.

Thus, the correct option is C.

For more details regarding multicellular organisms, visit:

https://brainly.com/question/24381583

#SPJ2

What organisms are capable of cellular respiration?

A. Heterotrophs only
B. Animals and fungus
C. Animals, fungus, and some bacteria
D. Protists
E. All organisms

Answers

the answer is E. All organisms

what is the complementary DNA of TACCGGATGCCAGATCAAATC?

Answers

Answer:

ATGGCCTACGGTCTAGTTTAG

Explanation:

A=T

C=G

G=C

T=A

This is the key to finding a complementary DNA strand.

Cross a heterozygous axial, hybrid round seed plant with a hybrid axial, heterozygous round seed plant. Only list the phenotypic ratio at the end.

Answers

Answer:

The phenotypic ratio is 9:3:3:1

9/16 individuals with axial flowers and rounded fruits, R-A-3/16 individuals with terminal flowers and rounded seeds, R-aa3/16 individuals with axial flowers and wrinkled seeds, rrA-1/16 individuals with terminal flowers and wrinkled seeds, rraa

Explanation:

We need to cross a heterozygous axial, hybrid round seed plant with a hybrid axial, heterozygous round seed plant. When referring to a hybrid plant for a trait, we are meaning that the plant is heterozygous for that trait.

Let us assume that round is the dominant trait, codified by a diallelic gene, so

R is the dominant alleler is the recessive allele

Let us also assume that axial is the dominant trait, so

A is the dominant allelea is the recessive allele    

Cross:

Parentals)   RrAa  x  RrAa

Gametes)  RA, Ra, rA, ra

                 RA, Ra, rA, ra

Punnett Square)     RA           Ra          rA          ra

                   RA      RRAA    RRAa      RrAA     RrAa

                   Ra      RRAa     RRaa       RrAa     Rraa

                   rA       RrAA     RrAa       rrAA      rrAa

                   ra       RrAa      Rraa        rrAa       rraa

F1) Among the progeny, we expect to observe the following phenotypic ratio:

9/16 individuals with axial flowers and rounded fruits, R-A-3/16 individuals with terminal flowers and rounded seeds, R-aa3/16 individuals with axial flowers and wrinkled seeds, rrA-1/16 individuals with terminal flowers and wrinkled seeds, rraa

PLEASE ANSWER THIS DUE BY 3:00 PM PLEASE
THIS IS NOT MULTIPLE CHOICE AND I DID NOT MEAN TO SELECT D.

( I put a better view of the graph)

Answers

Answer:

option C suits the best

Explanation:

The answers and why they are correct or incorrect:

A:

Incorrect because it cannot be answered with the graph and does not apply.

B:

Incorrect since the loudest sound ever recorded is not on the graph.

C:

Correct because the graph shows the difference Between normal conversation vs whispering.

D:

Incorrect, because like the first one it cannot be answered with this graph and makes no sense.

I HOPE I HELPED!!! HAVE AN AMAZING DAY/NIGHT!!! PLEASE MARK ME BRAINLIEST IF I HELPED YOU!!

What is the purpose of RNA?

To hate on DNA

To act as a messenger from DNA to the rest of the cell

No file uploads!!!!!!

Answers

Answer:

to act as a messenger from DNA to the rest of the cell.

Explanation:

I feel like this one was pretty self explanatory lmfa.o

WILL MARK BRAINLIEST
Part A: Design a food chain with four trophic levels, and identify the organism in each level. What happens to energy as it travels from the bottom up? (3 points)
Part B: Can humans ever occupy the lowest, or first, trophic level? Why or why not? (1 point)

Answers

Answer:

Part A: Primary producer - plants (ex: sunflowers), Primary consumers- herbivores(ex: rabbits), Secondary consumers - omnivores and carnivores (ex: snake), tertiary consumers - omnivores and carnivores (ex: foxes), A-p-e-x predators - can be omnivores or carnivores (ex: coyote)

Energy decreases as it travels from the bottom of an energy pyramid, every time energy passes from one tropic to another, the predator only gets 10% of the total energy, or the stored energy, the rest of the energy has already been used up.

Part B: Humans cannot ever occupy the lowest or first tropic level, because the first tropic level is for producers like plants, humans are not producers and therefore cannot be at the first tropic level.

PRODUCT
OR
11. (Circle one) Oxygen is a
released?)
REACTANT
of respiration? (In other words, is it needed or

Answers

Answer: ?

Explanation:

Please help, any unnecessary answers will be reported. Thanks :)

Answers

it's c

Explanation:

because there's different types of cold and illnesses so there can be different symptoms each time

genes for traits that help an organism be more successful reproductively can be expected to ...

A - cause it to evolve into species

B - eventually be eliminated by natural selection

C - become more common in the future

D- cause the extinction of the species

Answers

C - become more common in the future

What processes can increase the amount of atmospheric CO2?

Answers

Answer:

Explanation:

Carbon dioxide is added to the atmosphere naturally when organisms respire or decompose (decay), carbonate rocks are weathered, forest fires occur, and volcanoes erupt.

Carbon dioxide is also added to the atmosphere through human activities, such as the burning of fossil fuels and forests and the production of cement.

Answered by the One & ONLY #QUEEN aka #DRIPPQUEENMO

Hope This Helped !! :)

Human-induced emissions from fossil fuels contribute a relatively small amount of the increase in atmospheric CO2Deforestation and forest degradation reduces the removal component of this cycle, further increasing the carbon dioxide in the atmosphere

Other Questions
Which ribbon tab has the tool that lets you connect your text to a URL?HomeInsertReviewAnimations give an example of something that might stop a cell from checking things during the cell cycle why wasn't it possible for miners to simply scoop up gold CAN SOMEBODY HELP WITH MY SPANISH ALSO READ THE QUESTION PLZZ:(( One of the scientists suggests that he can build acooling system for the theoretical photovoltaic cellsExperiment 2, which will keep the cells 1C coolerdan normal but decrease their efficiency by 1%. Theteoretical photovoltaic cells capturing which frequencyranges, if any, would benefit from this cooling system? PLEASE HELP i need this done by 2pm PST Which of the following is NOT an element of impressionistic painting.A. PhotographyB. MoodC. colorD. PerspectivePlease help me answer this meaning of cell or cytology 50 POIINTS!!!A coin is flipped 20 times. The results are 12 heads and 8 tails. Determine the theoretical probability of getting heads.60%40%20%50%SOMEONE PLEASE PUT STEPS TO SOLUTION. Drilling creates vertical holes in a workpiece, while milling can machine complex 3d surfaces along with simple horizontal and vertical lines. true or false The process of heating oil to separate out its various components is called __a. hydraulic fracturing b. peak production c. refining d. decommissioning e. enrichment Read the excerpt below and answer the question.Upon its head, with red extended mouth and solitary eye of fire, sat the hideous beast whose craft had seduced me into murder, and whose informing voice had consigned me to the hangman.Analyze Poes word choices in this excerpt from The Black Cat. Pay particular attention to his use of the word seduced. The tone exhibited in this excerpt can be described as _____.embarrassedarrogantpassing blameguilt ridden Help, please I will mark the brainliest answer if right! please help!!factor the quadratic by using the box Which statement provides the best argument against making major changes to the atmosphere to help protect Earths resources? There will be less soil and dust in the air as construction increases. The atmosphere will improve as more people move to large cities. Making major changes to the atmosphere can be a costly process. It is more important to protect land and water resources than the atmosphere. how to simplify 12 16 Before we make measurements, let's make sure we understand the circuit. 1. Select all of the following that correctly describe what a volt meter and ammeter measure. Select all that apply: A volt meter measures the potential difference (or voltage) across a circuit element. A volt meter measures the potential difference (or voltage) passing through a circuit element. A ammeter measures the electric current passing through a circuit element. A ammeter measures the electric current across a circuit element. PLEASE HURRYLOgiving brainliest Rachel ran 5 miles every day last week. Her running time was as follows: 39min, 42 min, 41 min, 38 min, 39 min, 39min, 42min. What was her mean running time for 7 miles? Was Canada made a nation because of Vimy ridge? solve this riddle if i had 10 apple gave 3 to my friend gave 1 to myself gave 2 to my uncle and 1 to my mom how many do i have left Steam Workshop Downloader