How does interphase prepare cells for mitosis
rest prior to cell division
growth of cell and replication of DNA
dissolution of nucleus and cell membrane
division of cytoplasm

Answers

Answer 1

Answer:

In interphase there are three phases in which the cell multiplies its contents. DNA is replicated and cell organelles are doubled and all necessary biomolecules are formed. In this way cell gets prepared for mitosis.

Answer 2

Interphase is the time of the cycle when the cell grows and replicates DNA. Therefore, option  "A" is correct.

What is the cell cycle?

The cell cycle consists of a series of events in sequence by which the cell duplicates its genome and eventually divides into two daughter cells. It is divided into two phases i.e., M phase and interphase. Interphase is the preparatory phase for the cell to undergo cell division whereas the M phase is the mitosis phase in which the cell divides.

The interphase phase is further divided into four phases: G1- the period between the end of the M phase and the start of DNA replication.S- also known as the synthesis phase in which the synthesis of DNA occurs.G2-division of the cell.

Therefore, the cell cycle is an important event.

Learn more about the cell cycle, here:

https://brainly.com/question/25282664

#SPJ7


Related Questions

Global Warming is not a thing!

Answers

Answer:

This is not an answer

Explanation:

True, it’s more than a thing. Are you referring to a question or you are saying a statement?

What is the function of cholesterol?

to keep the cell membrane from falling apart
to line the arteries of organisms
to store energy
to give us quick energy

Answers

Answer:

to store energy

Explanation:

Its main function is to maintain the integrity and fluidity of cell membranes and to serve as a precursor for the synthesis of substances that are vital for the organism including steroid hormones, bile acids, and vitamin D. Cholesterol is essential for making a number of critical hormones, including the stress hormone cortisol. Cholesterol is also used to make the sex hormones testosterone, progesterone, and estrogen. 2 The liver also uses cholesterol to make bile, a fluid that plays a vital role in the processing and digestion of fats.

the process of which cells make proteins is called protein what?

this is a fill in the blank!

Answers

Answer:

protein biosynthesis

Explanation:

prove me wrong

Answer:

any of a class of nitrogenous organic compounds that consist of large molecules composed of one or more long chains of amino acids and are an essential part of all living organisms, especially as structural components of body tissues such as muscle, hair, collagen, etc.

Explanation:

I will mark brainest if you get it right
A photovoltaic cell captures ____ to be used for power.
A. Wind
B. Water
C. Coal
D. Sunlight

Answers

Answer:

D. Sunlight

Explanation:

Answer:

santa claus

Explanation:

what are the two main organs involved in the respiratory system?​

Answers

Answer: The respiratory system is the network of organs and tissues that help you breathe. It includes your airways, lungs, and blood vessels. The muscles that power your lungs are also part of the respiratory system.

Explanation: Your respiratory system is the network of organs and tissues that help you breathe. This system helps your body absorb oxygen from the air so your organs can work. It also cleans waste gases, such as carbon dioxide, from your blood. Common problems include allergies, diseases or infections.

What is the respiratory system?

The respiratory system is the network of organs and tissues that help you breathe. It includes your airways, lungs, and blood vessels. The muscles that power your lungs are also part of the respiratory system. These parts work together to move oxygen throughout the body and clean out waste gases like carbon dioxide.

nose and lungs i think

plzzz help i willl give you a Brainliest if you get it correct

Most scientists come up with questions to investigate out of the blue.

1.true

2. false

Answers

The answer is False

Answer:

the correct answer is false.

I NEED HELP

1. What are chromosomes?
2. What are the four phases of mitosis, in the correct order?
3. In what phase of mitosis are chromosomes moving toward opposite sides
of the cell?
4. Compare the two nuclei that form as a result of mitosis?
5. What is cytokinesis, and when does it occur?

Answers

Answer:

1. a chromosome is a dna strand that has genes

2. prophase, metaphase, anaphase, telophase

3. anaphase

4. the two nuclei are identical daughter cells and they have the same number of chromosomes

5. this is when the cell separates forming two new daughter cells and it occurs in the late telophase of mitosis.

sorry if this is wrong but this is how i learned it! hope it helps!

Explanation:

Bones provide attachments that allow skeletal muscles to cause movements? True or false

Answers

Answer:

True ...........................

when using a solar powered calculator what source of energy is being used to power the calculater

Answers

Answer:

UV rays

Explanation:

Solar energy and solar rays is what powers the calculator

Which of the following is NOT produced by
respiration
sugar
Ds ATP energy
carbon dioxide
water

Answers

Answer:

I think its water or sugar.

One danger of excessive nitrogen levels in water is BLANK.

Answers

Answer:

light

Explanation:

excessive nitrogen can harm water bodies excessive nitrogen can cause overstimulation of growth of aquatic plants and algae excessive growth of the organisms intern can clogged water intakes used to solve oxygen as they decompose and block light to deeper waters

Why are elements called
the building blocks of matter?
A. They stack up nicely.
B. They make-up all matter.
C. They make-up most of the matter around us.

Answers

Answer:

B

Explanation:

B. They make up all matter

What is the value of the expression 3 divided by 3/4

Answers

Answer:

4

Explanation:

If we have the expression, 3/3/4.

Then this is the same as 3 × 4/3

Which is the same as 12/3

Which is the same as 4

Hence the value of the expression 3/3/4 is 4

At the beginning of the film, director Ron Howard shows two contrasting scenes: The deaths of the Apollo 1 crew and a party celebrating the landing of Apollo 11 on the moon. How do these scenes foreshadow the rest of the movie?

Answers

Answer:

It foreshadows that the Apollo 11 made it to the moon, while Apollo 1 did not

Explanation:

A group of researchers wants to develop an experiment to determine whether a new drug effectively treats cancer. The researchers want to inject the drug in hamsters first to determine whether there are any potentially serious side effects.

Part A: What are some possible ethical issues with this type of testing?

Part B: While conducting the experiment, the researchers find cancer stops spreading, and they declare the new drug is responsible. Is this a good assumption? Explain.

Answers

Answer:

Part A: The animals are used for examining and determining the effect of a particular new drug for the treatment of the diseases and disorders before they are examined over humans. This practice is called as clinical trial.

The ethical issue associated with given type of testing is that animals have right to live and survive. They should not be subjected to the treatment where they experience harm or even death.

Part B: Those assigned to the control take a sugar pill. The only thing you want to vary across groups when you're conducting an experiment is the treatment. Since taking pills is a part of taking medication (the treatment), medical experiments often employ something called a placebo-controlled study where outcomes for those who are randomly assigned to take the medication are compared to outcomes for those who are randomly assigned to take a sugar pill. The sugar pill is expected to have no effect, so it serves as a useful baseline to compare the treatment to.

Answer:

The current code of ethics to be upheld in science experiments are as follows: the experiment must contain a clear scientific purpose, the animals must be housed and provided with care, the animals must be legally acquired, the least amount of suffering must be ensured, and the animals can only be used when it is entirely necessary.

In this paragraph, we can see the plan does not fit the code of ethics entirely- because this is a new drug, we can not be sure that this experiment will not be fatal for the animals, and that they will not suffer tremendously before passing on. The medicine should be tested first on a sample which is not living.

Explanation:

WILL GIVE BRAINLIEST!!!!!!!!!
In all living things, the presence of what structure supports the cell theory.

cell membrane

chloroplast

cell wall

vacuole

Answers

Answer:

chloroplast

Explanation:

Answer: the cell membrane

In the water cycle, water returns to the ground as precipitation. How does phosphorus return to the soil in the phosphorus cycle?
A.
Phosphates found in soil dissolves in water.

B.
Phosphates are absorbed by the roots of plants.

C.
Animals eat the plants that absorbed the phosphates.

D.
Animals that ate the plants die and decompose.

Answers

Answer:

D

Explanation:

Does eukaryotic cells need more lipids than prokaryotic cells

Answers

Answer: yes because they need more energy

Explanation:eukaryotes are more complex than prokaryotes

As you observe an unknown cell under a microscope, you make the following observations..

Answers

it is probably a plant cell because it has a cell wall and chloroplasts.

Answer:

It is a plant cell that is being observed

Explanation:

With in the cell, there are chloroplasts that ONLY a plant cell has. It also has a cell wall which an animal cell does not, so it is clearly not an animal cell.

What is a niche, and how does it relate to evolution?

Answers

Answer:

The evolution of species’ niches is a process that is fundamental to investigations in numerous fields of biology, including speciation, community assembly, and long-term regional and global diversification processes. It forms the nexus between ecological and evolutionary questions. Topics as diverse as ecological speciation, niche conservatism, species coexistence, and historical biogeography all rely on interpreting patterns and drivers of species’ niches through time and across landscapes. Despite this importance, a distinct research agenda concerning niche evolution as a discrete topic of inquiry has yet to emerge. Niche evolution is often considered as a sidebar or of secondary importance when addressing questions such as “how did two species diverge?” Basic questions such as “what is a niche,” “what is the biological basis of niche evolution,” “at what scale should we evaluate niche evolution,” and “how can we observe niche evolution at different timescales” have rarely been addressed directly, or not at all in some systems. However, various intellectual threads connecting these ideas are evident in a number of recent and historical publications, giving some semblance of form to a framework for interpreting and evaluating niche evolution, and outlining major areas for future research from an evolutionary perspective. There is a reverse perspective from the macroecological scale as well, with questions involving coexistence, distributions and ranges, food webs, and other organismal attributes

Explanation:

ye

In non-mendelian genetics, humans have 4 blood types in which A and B are codominant and o is recessive. I cross two parents with type AB blood. What is the percentage of children with type B blood?

A. 0%
B. 25%
C. 50%
D. 100%

Answers

Answer:

i think it may be 50 dont be mad if im wrong

Explanation:

recessive takes over from what i read i dont see any o so it can be half a half b so 50...

The spinal cord relays messages between the body and the brain. These messages control body functions like movement, bladder and bowel control and breathing. Each vertebra has a pair of spinal nerves that receive messages from the body (sensory impulses) and send messages to the body (motor impulses). The spinal nerves are numbered 1 to 55 from the neck down. The first eight as seen here are the vertebrate and send messages to the back of the head, neck, shoulders, arms, hands and diaphragm. A) cervical B) lumbar C) sacral D) thoracic​

Answers

The Correct answer is C

this is a cell not a plant, because the cell do not contain________

Answers

Answer:

Chloroplast.

Explanation:

This is what I believe it is since we're obviously talking about an animal cell and NOT a plant cell like it says. Animal cells do not contain chloroplast.

If this is the answer you're not looking for, let me know! Hope this helped! :)))

Peppered moths have learned to stay still (not move) on a tree trunk during daylight hours to avoid being eaten by birds. This is an example of...
A. Natural selection
B. Behavior adaptation
C. Structural adaptation
D. Selective breedeinh

Answers

Answer:

Behavior adaptation

Explanation:

Behavior adaptation is where a animal behaves in a different manner that suits its environment or keeps the animal safe

Choose all the answers that apply.
Binary fission _____.
is the type of reproduction used by bacteria
occurs in organisms that do not have a membrane bound nucleus
is a type of sexual reproduction creates identical copies of the parent cell
is a type of asexual reproduction

Answers

Answer:

A, B, D

Explanation:

Binary fission occurs primarily in prokaryotes, but can occur in eukaryotes. It is used by bacteria and is asexual reproductio, not sexual.

Explanation:

occurs in organisms that do not have a membrane bound nucleus. Explanation: Binary fission is an asexual mode of reproduction. As it does not involve formation and fusion of gametes.

Replication, Transcription, and Translation Chart

Please answer


DNA Replication:

1。Template Strand: Start with this nucleotide chain.

TACCCTTGAATAAAAAATCTCTGTTTGGTCGGTATTGTTGAAATC



2。Complementary DNA Strand: Write directly below template strand.


Transcription:

3。mRNA Strand: Write the complementary mRNA strand from the DNA template strand (#1).



Translation:

4。Anticodon: Write the anticodon sequence to match the mRNA strand (#3).



5。Protein Synthesis: Write the mRNA sequence that is complementary to the anticodons. Meaning the opposite code of the anticodons (#4).



6。Amino Acid Sequence: Create the amino acid sequence from protein synthesis using 3 letter abbreviation for amino acids (#5).

Answers

Answer:

jnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Explanation:

Why is sickle cell anemia so harmful to its carriers?

Answers

Answer: BECAUSE IT MAKES THE RED BLOOD CELLS SHRINK

Explanation:

Answer:

Sickle cell anemia is harmful to the body because it is enagering your spleen and with less healthy red blood cells circulating in the body, you can become chronically anemic.

Sickle cell anemia puts your body at more risk for infection.

Explanation:


Please help me with this and answer correctly.
Brainliest will give!! ​

Answers

Answer:

Sorry can't help

Explanation:

PLEASE GIVE ME BRAINLIEST

When writing experimental results, be sure to ALWAYS
A)
include the equipment used
B)
include any mistakes you made
include appropriate units on any mathematical results
D
include the names of the people who performed the lab experiment

Answers

Answer:

All of the above

Explanation:

Should include any equipment that you would need to use. Since it is an experiment you should include any mistakes you made during the experiment.

please help me Which example is a trace fossil?

dinosaur footprint


dinosaur bone


dinosaur egg


shark tooth

Answers

Dinosaur egg would be your answer.

Answer:

Dinasour footprint

Explanation:

6 grade science

Other Questions
Brian and Colin win some money and share it in the ratio 5:1. Brian gets 60 more than Colin. How much did they get altogether? AT LEAST how many cubes like this one need to be joined together to form another LARGER SIZED CUBE? What are the two most common formats of a business letter?Flyer and outlineFormal and informalCorporate and LLCBlock and indented 15. Politicians may be mocked by political cartoons when they make... A. unpopular decisions B. popular decisions C. wise decisions D. unique decision You're playing the slots and "win" twenty-five bucks! You're stoked.During the past ten weeks, you've won another fifty bucks.But you've dropped two bucks in the slot machines every day for ten weeks. What types of laws prevent advertisers from exaggerating the effectiveness of their products and services?Truth in advertising lawsFair trade lawsMarket equality lawsHonesty in marketing laws If the picture isn't clear I can provide another if it helps Sarah was thinking of a number. Sarah adds 5 then divides by 5 to get an answer of 8. Form anequation with x from the information. In interpersonal communication, why is it so important to think about the way we phrase things before we speak What creates a wall around the cell?A.Plasma MembraneB.NucleusC.RibosomesD.Endoplasmic Reticulum What was the opening statement for the plaintiff?The evidence shows that Mr. and Mrs. Smith knew they were buying a two-wheel drive and lied in order to get a better car.The evidence shows that the Auburn Bunston Dealership switched the labels on the car so it read 4WD.The evidence shows that the car was labeled incorrectly from the factory, and this is nothing more than an innocent mistake.The evidence shows that Bob led the Smiths to believe that the car they were buying was four-wheel drive when he knew it was not. answer these question for me plss Could somebody please help... Ill give a brainliest for a brainliest... on your next question Ill answer. In 1995, the population of a town was 33,500. It is decreasing at a rate of 2.5% per decade.a. Identify whether the function is a growth or decay function.b. Write the function, f(n), that expresses the population of the town after (n) decades.c. What is the population in the year 2025 to the nearest hundred? What type of microscopy works by allowing only light waves that have reflected from or refracted though the sample to enter the lens system triarsenic pentasulfide what is the formula? Plz help! Identify the function represented by the graph or table is linear or nonlinear 20 min! help!!Quadrilateral L M N O is reflected over a line to form quadrilateral C D A B. Quadrilateral LMNO is reflected over the line as shown, resulting in quadrilateral CDAB. Given the congruency statement LMNO CDAB, which segment corresponds to ML? AB AD CD DC The grades on a physics midterm at Covington are roughly symmetric with = 72 and = 2.0. Stephanie scored 74 on the exam. Find the scores for Stephanies exam grade. Round to two decimal places In which order would the following numbers come from least to greatest?-11/5, -2.4, 1.6, 15/10, -2.25 Steam Workshop Downloader