How many formula units are there in 50.3 moles potassium chloride?

Answers

Answer 1
Answer:

3.03 × 10²⁵ formula units KCl

General Formulas and Concepts:

Math

Pre-Algebra

Order of Operations: BPEMDAS

Brackets Parenthesis Exponents Multiplication Division Addition Subtraction Left to Right

Chemistry

Unit 0

Reading a Periodic TableWriting Compounds

Atomic Structure

Using Dimensional AnalysisAvogadro's Number - 6.022 × 10²³ atoms, molecules, formula units, etc.Explanation:

Step 1: Define

50.3 mol KCl (Potassium chloride)

Step 2: Identify Conversions

Avogadro's Number

Step 3: Convert

[tex]\displaystyle 50.3 \ mol \ KCl(\frac{6.022 \cdot 10^{23} \ formula \ units \ KCl}{1 \ mol \ KCl} )[/tex] = 3.02907 × 10²⁵ formula units KCl

Step 4: Check

We are given 3 sig figs. Follow sig fig rules and round.

3.02907 × 10²⁵ formula units KCl ≈ 3.03 × 10²⁵ formula units KCl


Related Questions

The reaction AgNO3(aq) + NaCl(aq) → AgCl(s) + NaNO3(aq) is a_________

reaction. please help

Answers

Answer:

it's a precipitation reaction.

Explanation:

the solid produced is insoluble with water–making it a precipitate.

HELPPPPPPPPPPPPPPPPPP!!!!!!!!!!!!!!!!

Answers

Answer:

dalton

Explanation:

believe his first name is james, if your not to sure search it

I think the only answer it Rurherford

Many organisms in an ecosystem compete with each other for resources. What might different species of trees in a forest ecosystem compete for?

Answers

Answer:

Water

Explanation:

Answer:

Water

Explanation:

Becasue the forest needs water to survie they may all compete for it.

Which of the following orbits the nucleus?

Select one:
a. proton
b. neutron
c. electron

Answers

electrons orbit the nucleus

Answer:

Electrons are the orbiting particles

Explanation:

Hope this helps UvU

A physical change is __________ if energy is given off.

Select one:
a. exothermic
b. endothermic
c. a chemical change
d. not possible

Answers

Answer:

A

Explanation:

In trying to control fall armyworms in crops, an Agriculture extension officer applied cypermethrin which was prepared by dissolving 200g of the cypermethrin , C22H19Cl2NO3 in 1000g of water H2O . Calculate the mole fraction of cypermethrin in the solution.

Answers

Answer:

Mole fraction for C₂₂H₁₉Cl₂NO₃ = 0.0086

Explanation:

Mole fraction remains a sort of concentration. It indicates:

moles of solute / (moles of solute + moles of solvent)

Moles of solute / Total moles.

Solute: Cypermethrin → C₂₂H₁₉Cl₂NO₃

Solvent: Water (PM = 18g/mol)

We calculate moles from solvent: 1000g /18 g/mol = 55.5 moles

We calculate PM for C₂₂H₁₉Cl₂NO₃

12g/mol . 22 + 1g/mol . 19 + 35.45 g/mol . 2+ 14g/mol + 16g/mol . 3 = 416 g/m

Moles of solute: 200 g / 416g/mol = 0.481 moles

Total moles: 0.481 + 55.5 = 55.98 moles

Mole fraction for C₂₂H₁₉Cl₂NO₃ = 0.481 moles / 55.98 moles = 0.0086

What actions can you take to reduce your impact on society?

Answers

Answer:

Cut Down On Waste. One of the simplest ways you can reduce your impact on the planet is by cutting down on waste. ...

Support Sustainable Companies. ...

Limit Your Meat Intake. ...

Reduce Energy and Water Use. ...

Offset Your Carbon Emissions. ...

Re-purpose, Recycle, and Borrow.

Explanation:

Plz mark brainliest thanks

For the reaction C+2H 2 —->CH 4 calculate the percent yield if 98 g of methane is produced when 100. g of carbon reacts with an excess of hydrogen?

Answers

The percent yield : 73.5%

Further explanation

Given

Reaction

C+2H₂⇒CH₄

Required

The percent yield

Solution

mol of Carbon(as a limiting reactant) :

[tex]\tt \dfrac{100}{12}=8.3[/tex]

mol CH₄ based on C, and from equation mol ratio C : CH₄, so mol CH₄ = 8.3

Mass of Methane(theoretical yield) :

[tex]\tt mass=mol\times MW\\\\mass=8.3\times 16=133.3~g[/tex]

[tex]\tt \%~yield=\dfrac{actual}{theoretical}\times 100\%\\\\\%yield=\dfrac{98}{133.3}\times 100\%=73.5\%[/tex]

What is the sequence in the formation of the Earth and the Universe?


The Earth and Universe formed around the same time


The Earth formed billions of years after the Universe formed


The Universe formed millions of years before the Earth formed


The Earth Formed before the Universe formed

Answers

Answer:

The Earth formed billions of years after the Universe formed

Explanation:

The "universe" is said to have been formed billions of year ago through an explosion. This was called the "Big Bang Theory." This lead to the expansion of the universe owing to its high temperature and density. After which, the universe cooled down. Galaxies and stars were then formed. Some of the stars died due to explosion, which then led to the creation of planets. Such formation of the planets happened around 4.5 billion years ago. This is 9.3 billions of years later than the universe was formed (13.8 billions of years ago). So, this explains the answer.

Convert the following word equation into a formula equation
fluorine + aluminum bromide → bromine + aluminum fluoride

Answers

Explanation:

Fluorine: F-

Aluminium: Al3+

Bromine: Br-

3F2 + 2AlBr3 => 3Br2 + 2AlF3

The balanced equation for the given chemical reaction can be given as

3F[tex]_2[/tex] + 2AlBr[tex]_3[/tex] [tex]\rightarrow[/tex] 3Br[tex]_2[/tex] + 2AlF[tex]_3[/tex]

What is balanced equation?

An equation for just a chemical reaction is said to be balanced if both the reactants as well as the products have the same number of atoms and total charge for each component of the reaction. In other words, both sides of both the reaction have an equal balance of mass and charge.

The products and reactants of a chemical reaction are listed in an imbalanced chemical equation, but the amounts necessary to meet the conservation of mass are not specified.

The balanced equation for the given chemical reaction can be given as

3F[tex]_2[/tex] + 2AlBr[tex]_3[/tex] [tex]\rightarrow[/tex] 3Br[tex]_2[/tex] + 2AlF[tex]_3[/tex]

Therefore, the balanced equation for the given chemical reaction can be given as

3F[tex]_2[/tex] + 2AlBr[tex]_3[/tex] [tex]\rightarrow[/tex] 3Br[tex]_2[/tex] + 2AlF[tex]_3[/tex]

To know more about balanced equation, here:

https://brainly.com/question/29769009

#SPJ2

Atoms of which element below are most likely to gain electrons?
Group of answer choices:

carbon

lithium

zinc

phosphorus

Answers

Answer:

Carbon and phosphorus

Explanation:

The atoms of carbon and phosphorus are most likely to gain electrons from the given choices .

The reason for this is because, both carbon and phosphorus are non-metals. Most non-metals usually accept electrons.

Metals are usually electron donors .

Metals are known for their electropositivity which is their ability to lose electrons. Non-metals are electronegative and will tend to have a strong affinity for electrons.

Helpz me pleaz! I don't quite get it

Answers

Answer:

Al2O3

Explanation:

Al2O3 has an ionic bond because the bonds between them are very strong

KBr and Al2O3 it’s due to relative size of oxygen and aluminum and polarizing power of Al

When the equations Na + O2 → Na2O is balanced the coefficient for O2 is
a) 1
b) 2
c) 3
d) 4

Answers

A) 1

4Na +O2 products to 2Na2O

The coefficient of oxygen gas (O2) in the following balanced equation is: 4Na + O2 → 2Na2O, is 1.

BALANCING EQUATION:

A balanced equation is an equation that contains the same number of atoms of each element on both sides of the equation.

Balancing a chemical reaction requires the use of coefficients, which are numbers placed in front of the elements/compounds involved.

According to this question, the following reaction is given:

Na + O2 → Na2O

The balanced chemical equation using coefficients is as follows:

4Na + O2 → 2Na2O

This balanced equation shows that 1 mole of oxygen is involved, hence, the coefficient is 1.

Learn more about coefficient of balanced equation at: https://brainly.com/question/21049751?referrer=searchResults

For the chemical reaction of ammonia combustion, write the expressions for velocity chemical reactions as a change in the concentration of all participants: 4 NH 3 (S ) + 5O 2 ( g )  4 NO ( g ) + 6 H 2 O ( g )

Answers

Answer:

See explanation

Explanation:

We define the rate of reaction as the rate of disappearance of reactants or the rate of appearance of products. The negative sign written before the rate of change of concentration of reactants shows that their concentration decreases with time.

The rate of reaction in terms of the concentration of each reactant or product is shown below;

Rate = -1/4d[NH3]/dt

Rate = -1/5d[O2]/dt

Rate = 1/4d[NO]/dt

Rate = 1/6[H2O]/dt

A sample of Nitrogen gas has a volume of 80.0 L at STP . If the temperature is held Constant what will the volume be at a pressure of 150 kPa?

Answers

Answer:

The final volume of the Nitrogen gas is 54.03 L.

Explanation:

Given;

initial volume of the Nitrogen gas, V₁ = 80 L

initial pressure of the Nitrogen gas, (at STP), P₁ = 101.3 kPa

final pressure of the Nitrogen gas, P₂ = 150 kPa

If the temperature is held constant, apply Boyle's law to determine the final volume of the Nitrogen gas.

V₁P₁ = V₂P₂

[tex]V_2 = \frac{V_1P_1}{P_2} \\\\V_2 = \frac{(80 \ L)(101.3 \ kPa)}{150 \ kPa} \\\\V_2 = 54.03 \ L[/tex]

Therefore, the final volume of the Nitrogen gas is 54.03 L.


N204(0) + 2NO2(g)
Colorless Brown
Keq = 6.16 x 103
What is the predicted direction of change?

Answers

setup 1 : to the right

setup 2 : equilibrium

setup 3 : to the left

Further explanation

The reaction quotient (Q) : determine a reaction has reached equilibrium

For reaction :

aA+bB⇔cC+dD

[tex]\tt Q=\dfrac{C]^c[D]^d}{[A]^a[B]^b}[/tex]

Comparing Q with K( the equilibrium constant) :

K is the product of ions in an equilibrium saturated state  

Q is the product of the ion ions from the reacting substance  

Q <K = solution has not occurred precipitation, the ratio of the products to reactants is less than the ratio at equilibrium. The reaction moved to the right (products)

Q = Ksp = saturated solution, exactly the precipitate will occur, the system at equilibrium

Q> K = sediment solution, the ratio of the products to reactants is greater than the ratio at equilibrium. The reaction moved to the left (reactants)

Keq = 6.16 x 10⁻³

Q for reaction N₂O₄(0) ⇒ 2NO₂(g)

[tex]\tt Q=\dfrac{[NO_2]^2}{[N_2O_4]}[/tex]

Setup 1 :

[tex]\tt Q=\dfrac{0.0064^2}{0.098}=0.000418=4.18\times 10^{-4}[/tex]

Q<K⇒The reaction moved to the right (products)

Setup 2 :

[tex]\tt Q=\dfrac{0.0304^2}{0.15}=0.00616=6.16\times 10^{-3}[/tex]

Q=K⇒the system at equilibrium

Setup 3 :

[tex]\tt Q=\dfrac{0.230^2}{0.420}=0.126[/tex]

Q>K⇒The reaction moved to the left (reactants)

Answer:

The system will shift toward the products

The system is at equilibrium

The system will shift toward the reactants

Explanation:

This is correct on edg... Good Luck!!!!

A group of students were discussing the lonization energies of Selenium and Flourine. Which student is correct for the reason why their element has the highest lonization energy? O A Student C says F because the larger the atom, the stronger the attraction between protons and valence electrons. The stronger the attraction the more energy is needed to remove a valence electron. B. Student B says Se because the smaller the atom, the stronger the attraction between protons and valence electrons. The stronger the attraction, the more energy is needed to remove a valence electron. C. Student D says F because the smaller the atom, the stronger the attraction between protons and valence electrons. The stronger the attraction, the more energy is needed to remove a valence electron. OD. Student A says Se because the larger the atom, the stronger the attraction between protons and valence electrons. The stronger the attraction the more energy is needed to remove a valence electron.​

Answers

I think the Answer is C because Flourine is stronger in electron attraction and is smaller so it has a stronger electronic pull. Hope this helps :)

Which of these goals of President Truman's "Fair Deal" were met?
A. Providing federal aid to education
B. Getting rid of the Taft-Hartley Act
C. Starting a national health insurance program
D. Expanding Social Security

Answers

The goals of President Truman's "Fair Deal" were met is to be considered as the option d. Expanding Social Security.

Reason for Truman's "Fair Deal":

Congress has approved Truman's extension of Social Security benefits, due to this it eliminates the national health care idea, that avoid any passing of new civil rights legislation, and failed to tackle concerns with respect to the fair labor practices.

Hence, the option d is correct.

And, the rest of the options are incorrect.

Learn more about health here: https://brainly.com/question/22618986

"Fair Deal" was a proposal given by Harry S. Truman, the president of America. The primary goal of the deal was to expand social security. Thus, option D is correct.

What was the "Fair Deal?"

"Fair Deal" was proposed by Truman to halt the inflation rate by controlling the economy, increase in the minimum wage structure, reform in agriculture, progressive tax layout, expansion of social security, etc.

Truman's fair deal was not a success and was a failure because of the rise in political conservatism. Social security was related to the national health care idea. Only three of his ideas in the deal were met at the end of the congress session others were a failure.

Therefore, the expansion of social security was met in Truman's "Fair Deal."

Learn more about "Fair Trade" here:

https://brainly.com/question/11801594

#SPJ5

Replication, Transcription, and Translation Chart
Please answer


DNA Replication:

1。Template Strand: Start with this nucleotide chain.

TACCCTTGAATAAAAAATCTCTGTTTGGTCGGTATTGTTGAAATC



2。Complementary DNA Strand: Write directly below template strand.


Transcription:

3。mRNA Strand: Write the complementary mRNA strand from the DNA template strand (#1).



Translation:

4。Anticodon: Write the anticodon sequence to match the mRNA strand (#3).



5。Protein Synthesis: Write the mRNA sequence that is complementary to the anticodons. Meaning the opposite code of the anticodons (#4).



6。Amino Acid Sequence: Create the amino acid sequence from protein synthesis using 3 letter abbreviation for amino acids (#5).

Answers

I can help with 1, 2, 3, and 4... 5 and 6, I don't understand.

Template sequence : TACCCTTGAATAAAAAATCTCTGTTTGGTCGGTATTGTTGAAATC

Complement sequence : ATGGGAACTTATTTTTTAGTGTCAAACCAGCCATAACAACTTTAG

mRNA sequence : AUGGGAACUUAUUUUUUAGAGACAAACCAGCCAUAACAACUUUAG

Anticodon sequence : AUG-GGA-ACU-UAU-UUU-UUA-GAG-ACA-AAC-CAG-CCA-UAA-CAA-CUU-UAG

(not 6) Protein synthesis : START-Gly-Thr-Tyr-Phe-Leu-Glu-Thr-Asn-Gin-Pro-Stop

name two life processes that viruses cannot carry out

Answers

Two life processes that viruses cannot carry out are Respiration and Sensitivity.

the person above said it i think

what is the purpose of chemistry?

Answers

Answer:

To know more about chemicals and how to utilise them to solve man's probl

2. Explain how to determine the wavelength of a wave.
Type your answer here.
I

Answers

Answer:

Hope it helps:)

Explanation:

Wavelength can be defined as the distance between two successive crests or troughs of a wave. It is measured in the direction of the wave. This means the longer the wavelength, lower the frequency. ...

To find the wavelength of a wave;

The wavelength is calculated from the wave speed and frequency by λ = wave speed/frequency, or λ = v / f.

Which one is correct? Please hurry, the audio is just reading the question!

Answers

I think it is D! Hope this helps

2. What is the smallest unit of an organism that is classified as living? *
10 points
A. an atom
B. a molecule
C. an organ
D. a cell

Answers

Answer:

D

Explanation:

The cell is the basic structural, functional and biological unit of all known living organisms. Cells are the smallest unit of life that is classified as a living thing, and are often called the "building blocks of life.

Answer:

a cell

Explanation:

All living things are made of cells; the cell itself is the smallest fundamental unit of structure and function in living organisms.

What is the momentum of a bird with a mass of 2 kg flying at 9 m/s? *

Answers

Answer:

18 kg.m/s

Explanation:

The momentum of an object can be found by using the formula

momentum = mass × velocity

From the question we have

momentum = 2 × 9

We have the final answer as

18 kg.m/s

Hope this helps you

What is the mass of 5 moles of Fe2(CO3)3 ?

Answers

Answer:

1218.585

Explanation:

Looking at the subscripts we know there are 2 atoms of Fe, 3 atoms of C, and 6 of O.

Take the molar mass of each atom (from the periodic table) and multiply by the # of atoms

Fe: 55.845×2= 111.69

C: 12.011×3= 36.033

O:15.999×6=95.994

Add the values together: 243.717 g/mol

That is 1 mole of the molecule. Multiply by 5 for the final answer.

243.717×5=1218.585

A small block of solid aluminum is removed from a freezer and heated from -5C to 5C in 5 minutes using a hot plate. The hot plate provides a constant rate of heat output during this time.

Answers

I think its a so sorry if wrongg !

How are mass and density different

Answers

Answer:

An object's density is the ratio of mass to volume of an object. The mass is how much it resists acceleration when a force is applied to it and generally means how much of an object or substance there is.

Answer:

brainleist

pls

Explanation:

An object's density is the ratio of mass to volume of an object. The mass is how much it resists acceleration when a force is applied to it and generally means how much of an object or substance there is.

Which of the alkaline-earth metals has the smallest ionization energy?

Answers

Answer:

Cesium

Explanation:

plzzzzzzzzzzzzz help i will mark you brainlest true orfalse/Air masses are responsible for the weather in a region

Answers

Answer:

True

Explanation:

Answer:

It is true!

I hope this helps. Have an awesome day <3

Other Questions
According to the Preamble to the Constituion, what is one purpose of government People who wanted free land through the Homestead Act needed to:O A. vote in state government elections.O B. wait five years before beginning to farm.O C. complete government training programs.O D. be able to build a house and farm. y -3 =9 solve for y 4w = 24 solve for w y -3 =9 solve for y Dont know this pleaseee help meee asappp Use the graph to find the value of y = sin q for the value of q.90 In a survey, one-fifth youths like cell phone only and 16 did not like cell phone at all. Also 60%youths like camera but 8 like none of them.(i) Show the above information in a Venn diagram.(ii) How many youths like both the things? 13. a person in position of authority who exercises power oppressively or unjustlyLoyalistMinutemenEffigyTyrant According to the Law of Conservation of Energy, why does the first hill on a roller coaster always have to be the tallest of all the other hills? Which values from the given replacement set make up the solution set of the inequality? True or False: 7>11>15>19The number to complete the pattern is 4.If > = To and < = FromA) TrueB) False Ik it's weird but i just wanna know your guy's aim. Coz i am not sure abt mine.. whats happened to vernon chandler's photo in the picture hanging on the wall Which are examples of genetic engineering? Check all that apply.building a rover to explore the surface of Marsproducing human insulin in bacteriaengineering an insect-resistant strain of wheat using a bacterial gene for a toxinengineering a bridge to be corrosion-resistant using a material made from graphite, aproducing a spider protein in cow's milk and making it into a new type of threadDONEIntro What does freedom mean to you and why? complete this setences I have only general idea about...from my homework scores I can generalize that......PLEASE HELP PLEASE!! THIS IS URGENT! PLEASE HELPP What is the distance between points A and B?A number line going from 0 to 2 in increments of 1. There are 3 equal spaces between each number. Point A is one mark to the right of 1. Point B is one mark to the right of point A.One-thirdOne-half1 One-third1 One-half 3. Two vehicles are broken down on the side of the road. One is a small sports car and the other is a delivery truck. The drivers need to push the vehicles forward onto the shoulder of the road. The drivers are about the same size. Each driver stands at the back of his vehicle and pushes. For 4 weeks in June, Cameron biked 3 1/4 miles each week and swam 2 1/2 miles each week. For 3 weeks in July, he biked 4 3/4 miles each week and swam 3 1/2 miles each week factor x(20-x)=96 its for solving quadratics Abandoned mines frequently fill with water. Before an abandoned mine can be reopened, the water must be pumped out. The size of pump required depends on the depth of the mine. If pumping out a mine that is D feet deep requires a pump that pumps a minimum of + 4D 250 gallons per minute, pumping out a mine that is 150 feet deep would require a pump that pumps a minimum of how many gallons per minute?Individual Question3625008001,2501,750 Steam Workshop Downloader