How many moles are in 5.32 x 1020 atoms
of copper?
What is the answer but in numbers ?

Answer:

They have similar chemical properties.

Explanation:

james madison test

The elements in a group on the periodic table have in common that they all are arranged on the basis of the number of electrons in the outer most shell of the atom.

The periodic table of  elements is defined as in which the classified all the non metals accordance with their properties in such a way that with similar properties are grouped.

Moosley arranged the elements in increasing order of their atomic number and observed that after a certain time of interval elements with same properties are repeated.

Therefore, elements in a group on the periodic table have in common that they all are arranged on the basis of the number of electrons in the outer most shell of the atom.

Learn more about periodic table, here:

https://brainly.com/question/11155928

#SPJ6

Answer:

False.

Explanation:

Answer:

Volume also reduced to half

Explanation:

Volume and absolute temperature are directly proportional to each others

Answer:

1.301 × 10⁻¹² m

Explanation:

Step 1: Given and required data

Step 2: Calculate the wavelength (λ) of the electromagnetic wave

We can calculate the wavelength of the electromagnetic wave using the Planck-Einstein's relation.

E = h × c / λ

λ = h × c / E

λ = (6.626 × 10⁻³⁴ J . s) × (3.00 × 10⁸ m/s) / 1.528 × 10⁻¹³ J

λ = 1.301 × 10⁻¹² m

The wavelength of this wave is equal to: D. [tex]1.301 \times 10^{-12}\;meter[/tex]

Given the following data:

To determine the wavelength of this wave, we would apply Einstein's equation for photon energy:

Mathematically, Einstein's equation for photon energy is given by the formula:

[tex]E=\frac{hc}{\lambda}[/tex]

Where:

Making [tex]\lambda[/tex] the subject of formula, we have:

[tex]\lambda = \frac{hc}{E}[/tex]

Substituting the given parameters into the formula, we have;

[tex]\lambda = \frac{6.626 \times 10^{-34}\; \times \;3.0 \times 10^{8}}{1.528 \times 10^{-13} }\\\\\lambda = \frac{1.99 \times 10^{-25}}{1.528 \times 10^{-13} }\\\\\lambda =1.301 \times 10^{-12}\;meter[/tex]

Read more: https://brainly.com/question/9655595

Explanation:

When liquid isopropanol (C3H8O) burns in oxygen gas, carbon dioxide gas and liquid water are produced. When dissolved sodium hydroxide reacts with sulfuric acid, aqueous sodium sulfate and water are formed.

Answer:

The compound you are asking for is not complete. But I will give you the answer to one of the compounds.

The complete compound is:

2-bromo, 3-chloro-4,4-dimethylpentane.

Attached is the structure of the compound.

Explanation:

2-bromo, 3-chloro-4,4-dimethylpentane is an organic compound. It's molecular formula is C₇H₁₄BrCl.

This compound has bromine and chlorine attached to the backbone carbon of the pentane compound. The bromine and chlorine are attached to the second and third backbone carbon of the compound respectively.

Also, the dimethyl means that the compound has two methyl (CH₃) attached to the same carbon which is the number 4 backbone carbon.

Answer:

Synthesis

Explanation:

A+B=C

Answer:

H2O2

Explanation:

I know it's been awhile since the question was asked but for future people like me its H2O2 I got it right in the quiz.

The whole-number multiple is obtained by dividing its molar mass (34.02 g/mol) by the empirical formula mass. H₂O₂ is the molecular formula of a compound that is composed of 94.1% O and 5.9% H with a molar mass of 34g.

The mass of a sample of a chemical compound divided by the quantity, or number of moles in the sample, measured in moles, is known as the molar mass of that compound. The molar mass of a material is a bulk attribute rather than a molecular one.

The mass of 6.022 × 10²³ atoms, molecules, or formula units of a material are equal to its molar mass, which is the mass of 1 mole of that substance represented in grams per mole.

Molar mass is a crucial factor to consider while planning an experiment. The molar mass enables you to calculate the quantity you should weigh out on your scale when testing theories that call for specified amounts of a material.

Thus, H₂O₂ is the molecular formula of a compound that is composed of 94.1% O and 5.9% H with a molar mass of 34g.

To learn more about molar mass follow the link;

https://brainly.com/question/12127540

#SPJ3

Answer:

Carbon and phosphorus

Explanation:

The atoms of carbon and phosphorus are most likely to gain electrons from the given choices .

The reason for this is because, both carbon and phosphorus are non-metals. Most non-metals usually accept electrons.

Metals are usually electron donors .

Answer:

When atoms lose or gain electrons, they become positively or negatively charged ions. In an ionic compound, the ions are arranged in a three-dimensional structure called a crystal. ... When an atoms gains or loses electrons, it gains a charge, thus becoming an ion.

Explanation:

Answer:

The iron ore deposits began forming when the first organisms capable of photosynthesis began releasing oxygen into the waters.

Explanation:

I can help with 1, 2, 3, and 4... 5 and 6, I don't understand.

Template sequence : TACCCTTGAATAAAAAATCTCTGTTTGGTCGGTATTGTTGAAATC

Complement sequence : ATGGGAACTTATTTTTTAGTGTCAAACCAGCCATAACAACTTTAG

mRNA sequence : AUGGGAACUUAUUUUUUAGAGACAAACCAGCCAUAACAACUUUAG

Anticodon sequence : AUG-GGA-ACU-UAU-UUU-UUA-GAG-ACA-AAC-CAG-CCA-UAA-CAA-CUU-UAG

(not 6) Protein synthesis : START-Gly-Thr-Tyr-Phe-Leu-Glu-Thr-Asn-Gin-Pro-Stop

Answer:

True

Explanation:

Answer:

It is true!

I hope this helps. Have an awesome day <3

setup 1 : to the right

setup 2 : equilibrium

setup 3 : to the left

The reaction quotient (Q) : determine a reaction has reached equilibrium

For reaction :

aA+bB⇔cC+dD

[tex]\tt Q=\dfrac{C]^c[D]^d}{[A]^a[B]^b}[/tex]

Comparing Q with K( the equilibrium constant) :

K is the product of ions in an equilibrium saturated state  

Q is the product of the ion ions from the reacting substance  

Q <K = solution has not occurred precipitation, the ratio of the products to reactants is less than the ratio at equilibrium. The reaction moved to the right (products)

Q = Ksp = saturated solution, exactly the precipitate will occur, the system at equilibrium

Q> K = sediment solution, the ratio of the products to reactants is greater than the ratio at equilibrium. The reaction moved to the left (reactants)

Keq = 6.16 x 10⁻³

Q for reaction N₂O₄(0) ⇒ 2NO₂(g)

[tex]\tt Q=\dfrac{[NO_2]^2}{[N_2O_4]}[/tex]

Setup 1 :

[tex]\tt Q=\dfrac{0.0064^2}{0.098}=0.000418=4.18\times 10^{-4}[/tex]

Q<K⇒The reaction moved to the right (products)

Setup 2 :

[tex]\tt Q=\dfrac{0.0304^2}{0.15}=0.00616=6.16\times 10^{-3}[/tex]

Q=K⇒the system at equilibrium

Setup 3 :

[tex]\tt Q=\dfrac{0.230^2}{0.420}=0.126[/tex]

Q>K⇒The reaction moved to the left (reactants)

Answer:

The system will shift toward the products

The system is at equilibrium

The system will shift toward the reactants

Explanation:

This is correct on edg... Good Luck!!!!

Answer:

I think it will start to have a greenish color and get lighter

Explanation:

Answer: The atom has three components the electrons, neutrons and protons.

Explanation:

J.J Thomson is responsible for the discovery of electron. He discovered the electrons while determining the properties of cathode rays in 1897. Rutherford is responsible for the discovery of proton during 1909 while performing the gold foil experiment. W. Bothe and H. Becker is credited to the discovery of neutrons.                          

Answer:

From the periodic table, Atomic number of fluorine is 7 and atomic mass is 19

Answer:

An independent variable is exactly what it sounds like. It is a variable that stands alone and isn't changed by the other variables you are trying to measure.

Answer: Boiling water

Explanation:

I think the Answer is C because Flourine is stronger in electron attraction and is smaller so it has a stronger electronic pull. Hope this helps :)

Answer:

Ca2+ is larger than Mg2+

Explanation:

Mg2+ has total 10 electrons and Ca2+ has total 18 electrons. So, Ca2+ will have more no of subshell which means greater particle size.

Answer: The answer is C- comets!                                                                            

Explanation:  Callisto is composed mainly of rock and water ice, although other ices like ammonia ice and carbon dioxide ice may be present. Water ice occurs at the surface of Callisto so it would be comets.

Answer:

B) Percent yield = 56%

Explanation:

Given data:

Mass of potassium iodide = 23 g

Mass of lead iodide formed = 18 g

Percent yield = ?

Solution:

Chemical equation:

2KI + Pb(NO₃)₂    →     2KNO₃ + PbI₂

Number of moles of potassium iodide:

Number of moles = mass / molar mass

Number of moles = 23 g/ 166 g/mol

Number of moles = 0.14 mol

Now we will compare the moles of PbI₂ and KI:

                      KI          :           PbI₂        

                      2           :             1

                      0.14      :          1/2×0.14 = 0.07        

Theoretical yield of PbI₂:

Mass = number of moles × molar mass

Mass = 0.07 × 461 g/mol

Mass =  32.27 g

Percent yield:

Percent yield = actual yield / theoretical yield × 100

Percent yield = 18 g/ 32.27 g × 100

Percent yield = 56%

The average speed

3. 89.7 m/min

4. 6.13 ft/min

Given

3. 1076 m in 12 min

4. 92 ft in 15 min

Required

average speed

Solution

3.

I am solving for : the average speed

The equation I need is :

[tex]\tt avg~speed=\dfrac{total~distance}{total~time}[/tex]

This is how I set the equation

[tex]\tt avg~speed=\dfrac{1076~m}{12~min}[/tex]

This is my answer = 89.7 m/min

4.

I am solving for : the average speed

The equation I need is :

[tex]\tt avg~speed=\dfrac{total~distance}{total~time}[/tex]

This is how I set the equation

[tex]\tt avg~speed=\dfrac{92~ft}{15~min}[/tex]

This is my answer = 6.13 ft/min

Answer:

To know more about chemicals and how to utilise them to solve man's probl

Answer:

No. of molecules= mass/molar mass ×avogadro no.

                         =  13.2/50×6.02×10°23

  No. of molecules =1.59×10°23

Explanation:

Answer:

1218.585

Explanation:

Looking at the subscripts we know there are 2 atoms of Fe, 3 atoms of C, and 6 of O.

Take the molar mass of each atom (from the periodic table) and multiply by the # of atoms

Fe: 55.845×2= 111.69

C: 12.011×3= 36.033

O:15.999×6=95.994

Add the values together: 243.717 g/mol

That is 1 mole of the molecule. Multiply by 5 for the final answer.

243.717×5=1218.585

the answer would be B

the particles wouldnt break, nor would the form new particles or just disappear

Answer:

D

Explanation:

The cell is the basic structural, functional and biological unit of all known living organisms. Cells are the smallest unit of life that is classified as a living thing, and are often called the "building blocks of life.

Answer:

a cell

Explanation:

All living things are made of cells; the cell itself is the smallest fundamental unit of structure and function in living organisms.

Answer:

A

Explanation:

The products of a chemical equation is what is being experimented with. However, the results in which you get are known as your solution.