la palabra recibió es hiato o diptongó?

Answers

Answer 1
Diptongo creo que es

Related Questions

MOVERSE Encuentra la forma adecuada de moverse en la letra. 1. yo I 2. tú 3. el padre 4. todos 5. nosotros​

Answers

Answer:

1.yo creo que un humano al MOVERSE genera mucha energía y animo

2.tú acustumbras temblar al MOVERSE.

3.el padre al MOVERSE le dan escalofrios.

4.hoy todos nos acostumbramos que al MOVERSE nos consideramis unos inquietos.

5.nosotros al MOVERSE ponemos en practica actividad humana.

Answer:

Yo me muevo para cambiarme de lugar

Tú te mueves una vez que se desocupe aquel lugar.

El padre se mueve de la sacristía hacia el púlpito y da su homilía.

Todos nos movemos al ritmo de esa música que ha traspasado generaciones.

Nosotros nos movemos para abordar el autobús.

whats the opposite of pequeño in spanish

Answers

Answer: grande is the answer

Explanation: grande

Decide whether the sentence is grammatically CORRECT or INCORRECT as written.

Mi mamá se sienta en el sofá.

Answers

Answer: the grammar is right

so yes this is correct

Explanation:

Correct because it says my mom is sitting in the couch

Translate the two paragraphs to English

Answers

Answer:

a boy named Pepe. Pepe's a good student. he's very studious. Your class

favorite is the English class. But Pepe is very messy, for Pepe, no

be orderly. For classes, Pepe needs a lot of things 1. Pepe needs a calculator

for algebra class. He needs a notebook for his chemistry class, he needs some pencils.

color for art class. She needs a book for her geography class. Need the task

for the technology class, you also need a dictionary for the English class. All

things are in Pepe's backpack. Pepe's ready for school.

In the first hour, Pepe has algebra class. Pepe looks for the calculator in the backpack.

no! The calculator's not in the backpack. The professor's not nice. Teacher

he's angry 4. Pepe gets extra homework from the teacher.

In the second hour, Pepe has chemistry class. Pepe looks for the notebook in the backpack

no! The notebook is not in the backpack. Professor chemica is not nice. Pepe need

sitting outside the classroom.

Answer:

you can go to Google Translate type it in Spanish and then it will put in English

Explanation:

Review the phrases that you learned in the tutorial Technology at Home. Use those phrases, a
the word bank below, to discuss your likes and dislikes. Your response should include 8-10 s
response and upload the audio file when you submit the unit activity to be graded.

Answers

Answer:

I made a small paragraph, I hope it helps you

Explanation:

 Hola, creo que estudiar desde casa ha sido una nueva experiencia y creo que quedará en los libros de historia el cual en este tiempo pude aprender hacer varias cosas, puede pasar tiempo con mis amigos mientras jugaba videojuegos, vi varios video acerca como bailar salsa pero creo que eso lo mismo también aprendí nuevas técnicas de dibujo y creo que ha sido un buen año, espero que termine bien :)

gracias

In Spanish, you are going to ask a girl (Ella) and a boy who they are (EI) ¿Quiénes son? and where they are from. ¿De dónde son? Soy de... They are friends from the same country but they live in different cities. Find a Spanish speaking country and two different cities within it. They are going to tell you what their nationality is ¿De dónde son Uds? Answer with the Nosotros form ( Nosotros somos plus nationality. They will also say that they are friends. YO: I Marta: Juan: Nosotros​

Answers

Answer:

- Hola, yo me llamo Yalitzia, ¿Cuál es tu nombre?

- Mi nombre es Antelmo

- Yo soy de El Salvador, ¿De donde eres tú?

- Yo soy de Nicaragua, pero vivo en Zacatecoluca allá en El Salvador

- Yo vivo en Apastepeque también en El Salvador

- Quien lo diría que ahora nos venimos conocer y entablar nuestra amistad acá en Mixco en Guatemala.

- Entonces yo soy salvadoreña y tu eres nicaragüense

- Así es

- Te presento a mis dos mejores amigos, son Tiago y Lorenzo.

- Mucho gusto, ¿De donde son Ustedes?

- El gusto es nuestro, nosotros somos de Honduras, somos hondureños, vivimos en San Pedro Sula. Somos amigos que nos conocimos allá en Tegucigalpa

-Me da mucho gusto conocerlos y espero que nos podamos seguir viendo.

-Así lo esperamos también nosotros y que podamos pasearnos por los alrededores.

What does de do de es Fernando mean

Answers

I am assuming you mean "de donde es Fernando?"

This translates to "Where is Fernando from?"

Uhm I never heard of "de do de es" but I'll assume you mean "de donde es," which means where is Fernando from?

Would someone be able to help me with my Spanish homework? You have to create 8 different sentences.

Answers

Ellos son chismosos.
Tu eres simpática.
Yo soy alta.
Yo quiero hacer la comida para mi familia.
En Peru son bonitas casas.
La televisión es grande.
Mi amiga tiene un camera.
Me gusta galletas.

Los pronombres posesivos
A Da la forma masculina del pronombre.
1. mi →
2. su →
3. nuestro →
4. tu →
5. sus →
6. tus →
B. Cambia según el modelo.
MODELO mi cámara → la mía
1. tu mascota
2. nuestra casa →
3. mi novio →
4. sus anillos →
5. nuestro anuncio →
6. tus regalos →
7. mis trajes →
8. mi fresta →

Answers

Mío

Suyo

Nuestro

Tuyo

Suyos

Tuyos

Tuya

Nuestra

Mío

Mis

Nuestro

Sus

Mis

Mi

Diferencia entre b y v

Answers

Answer:La diferencia es que ambas describen a diferentes objetos.

Explanation:

Ambas van en palabras diferentes.

What formal command would a nurse with a new patient use for the verb
descansar?
Descanses
Descansas
Descanse
Descansa

Answers

Descanse o Descansa

Depende de que manera lo valla a usar

Answer:

Descance

Explanation:

Ex. Porfavor Descanse un poco para que se sienta mejor

      Please take a little rest so that you feel better.

      vote and heart me thanks :)

I need help with this, I'm confused about it.

Answers

I think it is
Masculine: el, los, un and unos
Feminine: la, las, una and unas

LOOK AT PICTURE I WILL MARK BRAINLIST

Answers

The second one! Hope this helped have great day

¿Qué consecuencias trajo la reducción o eliminación de impuestos y cargas tributarias para el gobierno de Iturbide?

Answers

Some of the consequences that the reduction or elimination of taxes and tax charges brought for the Iturbide government were:

Hola!

1. Lack of resources to pay the expenses of the military troops.

2. Government budget deficit

3. inability to pay salaries to public employees.

The Iturbide Government was a government that lasted only nine months, because it did not have an economic plan, and the measures taken were very wrong, causing a great internal crisis.

~I hope I helped you! :)~

Answer:

SORRY I NEEEDDDD POOIINT S

S

Explanation:

create a story that illustrates various ways of preventing diseases that affect the respiratory and circulatory system​

Answers

El jabón quita gérmenes y bacterias

how do u say the spanish class starts at 12.07 in spanish

Answers

Answer:

la clase enpiesa al las 12:07

Explanation:

Answer:

La clase de español empeiza a las doce y diecisiete

Explanation:

Hope that helps

Instrucciones: ESCRIBE 10 reglas que creas que apliquen en tu salón de clase, o que te gustaria que estuvieran
contempladas en el reglamento escolar.​

Answers

Answer:

1.mas limpieza

2.mas orden

3.que todos opinemos

4.explicacion de tareas

5.que no halen mucho cuando estemos en clase

Explanation:

1) prestar atención
2)respetar al maestro
3) mantener orden
4)ser puntual
5) ser responsable
6) respetar las reglas del buen oyente y hablante
7) no dejar basura en el salón de clase
8) pedir ayuda si es necesario
9) respetar a tus compañeros
10) ser honesto

Fill in the blanks with the correct present tense forms of the verbs in parentheses.

A las seis de la mañana yo (1)_______(correr) al Parque. Mi familia (2)_________(vivir) cerca del parque, entonces (3)__________(correr) sólo tres kilómetros cada mañana. Cuando (4)_________(regresar) a mi casa, mi familia y yo (5)_________(desayunar). Luego voy a la escuela.

Answers

Answer:

A las seis de la mañana yo (1)corro al Parque.

Mi familia (2) vive cerca del parque, entonces (3) corro sólo tres kilómetros cada mañana. Cuando (4) regreso a mi casa, mi familia y yo (5) desayunamos. Luego voy a la escuela.

HEY CAN ANYONE ANSWER DIS SPANISH HW PLS!!!!!!!!!

Answers

Answer:

1: Whats your name?

Answer: Me llamo __(your name)__

2. How are you?

Answer: Soy buena

3. Where are you from?

Answer: soy de __(your state)__

4.Who is your best friend

Answer: Mi mejor amiga es __(her name)___

5.

Explanation:

1. Escucho atento las indicaciones antes
del examen.

Answers

Answer: He listened carefully to the indications before

of the exam. I hope this helps.

Explanation:

come te caen los otros escritores que conociste?

Answers

Answer:

Me caen muy bien son excelentes escritores y mejores personas.

Warm-Up: Make a list of the months for fall and winter in
Spanish

Answers

Answer: septiembre, octubre, noviembre, diciembre, enero, febrero.

Explanation:

No capitals btw

Answer:

Fall (otoño): septiembre, octubre, noviembre, diciembre

Winter (invierno): diciembre, enero, febrero, marzo

I need someone that knows spanish well and can translate this perfectly, dont use google translate please, my teacher can tell when someone does it. I need it to say...

I forgot my keys could you run some errands for me. Can you go to Walmart and pick up some groceries and then stop and get some food from zaxbys, and finally can you pick up my brother from school, it is right by the old middle school. Do not rush yourself, be careful.

Thats what I need in spanish, only use present tense please, thank you to whoever answers this

Answers

Answer:

me olvide mis llaves puedes hacerme unas diligencias. Puedes ir a Walmart I cojer las compras, y despues para a comprar comida en Zaxbys.  Y finalmente puedes recoger a mi hermano de la escuela, esta justo por la vieja escuela secundaria.  No te apures, ten cuidado

Explanation:

Answer:

"Olvidé mis llaves,

¿Podrías ayudarme haciéndome algunos mandados?

¿Puedes ir al Walmart y escoger algunos dulces y pasar por algo de comida al Zaxbys?

Y finalmente, ¿puedes recoger a mi hermano en la escuela? La escuela está  cerca de la vieja escuela secundaria. No te vayas corriendo, tranquila, con cuidado."

What does que mean? in spanish please help me it will be great thanks so much

Answers

Answer:

"que" means "what"

Explanation:

hope this helps!

Answer:

que means what in english

Please somebody help me!!!!!!!

Rewrite using DOPs. These stars (**) next to some of these sentences means there are 2 ways to write it. Please write both ways.
Remember: direct objects replace nouns. The noun(s) usually is at the end of the sentence that needs to be replaced.
New sentence format: Subject + (no) DOP + verb


1. Los niños comen las frutas.

2. Ella no dice la verdad.

3. Los estudiantes traen los libros.

4. Yo traigo la tarea.

5. Tú vas a comprar la ropa. **

6. Nosotros miramos las películas.

7. Kameron busca el auto.

8. Vosotros no leéis las cuentas.

9. Ustedes invitan a Miguel y yo.

10. Salma y yo visitamos a las chicas.

11. Yo voy a escribir las cartas. **

12. Tú practicas los deportes.

13. Ella va a jugar el partido. **

14. La maestra enseña la lección.

15. Sandra y Jorge viven la vida loca.

16. Nosotros vamos a aprender los verbos. **

17. Miguel interrumpe a Elena.

18. El perro ladra al gato.

19. Los padres gritan a los niños.

20. La cantante canta la canción.

Answers

Answer:

1. Los niños las comen.

2. Ella no la dice.

3. Los estudiantes los traen.

4. Yo la traigo.

5. Tú la vas a comprar OR Tú vas a comprarla.

6. Nosotros las miramos.

7. Kameron lo busca.

8. Vosotros no las leéis.

9. Ustedes nos invitan.

10. Salma y yo las visitamos.

11. Yo las voy a escribir OR Yo voy a escribirlas

12. Tú los practicas.

13. Ella lo va a jugar OR  Ella va a jugarlo

14. La maestra la enseña.

15. Sandra y Jorge la viven loca.

16. Nosotros los vamos a aprender OR Nosotros vamos a aprenderlos.

17. Miguel la interrumpe.

18. El perro lo ladra.

19. Los padres los gritan.

20. La cantante la canta.

Explanation:

How would you conjugate “Amar” to say “they loved”?
amo
amas
amamos
amaron

Answers

Answer:

amaron

Explanation:

amo is for first person: yo amo

amas is for second person: tu amas

amamos is for first plural person: nosotros amamos

amaron is for third person: ellos/ellas amaron.

¿Qué palabra no conoce Cortés para simplificar su descripción de las dos
montañas?

Answers

Answer:

Explanation:

El usa la palabra "mezquita". Lo usa para dar a Carlos V para asociar la religion de los Aztecas con los musulmanes y crear un sentimiento negativo y pesimista ya hacia los Aztecas.

What are the cities?​

Answers

1. Las Vegas

2. Boca Raton

3. El Dorado

4. Casa Grande

5. Punta Gorda

Answer:

i only got las vegas sorry about that

Explanation:

im writing here so that brainly wont take my answer down

1) Completa el párrafo con las formas correctas de "ser" o "estar".
Do you remember the conjugations? I will give you the forms with an accent here, in case you would like to copy and paste them. If you don't use the accent, your answer will be counted as wrong.
estás, está, están
This is what I do to put accents on letters on a Mac: option e and o makes ó, option e and a makes á, etc.

1. Miel ___ el perro de Juanito. *

2. Miel tiene tres años y ___ un perro muy bonito e inteligente. *

3. Miel y Juanito ___ buenos amigos y les gusta jugar mucho. *

4. Hoy, Miel ___ triste, *

5. porque Juanito ____ muy ocupado y no puede jugar. *

6. Juanito ___ estudiante de la escuela San Francisco. *

7. Él ___ nervioso porque mañana tiene exámenes finales. *

8. ____ las nueve de la noche y tiene que estudiar mucho. (do not capitalize) *

9. Guau, guau. Miel ____ enojado porque tiene hambre. *

10. ____ en la cocina pero Juanito no lo escucha en su cuarto porque escucha música. (do not capitalize) *

2) Completa las oraciones con la forma correcta de "ser" o "estar".
1. _____ las ocho y cuarto. (do not capitalize) *

2. Mis amigos y yo ____ en el cine. *

3. Mañana ___ mi cumpleaños. *

4. Yo ___ la maestra. *

5. Los pantalones ____ negros. *

6. Mi amiga ___ enferma hoy. *

7. Yo ___ inteligente. *

8. Ella ___rubia. *

9. Hoy ___ miércoles. *

10. ____ la una y veinte de la tarde. (do not capitalize) *

11. Nosotros ____ en Oakland. *

12. Mi amiga ___ de Cuba. *

Answers

Answer:

1miel ser el perro de juanito

2miel tiene tres anos y ser un perro muy bonito inteligente

3miel y juanito ser buenos amigos y les gusta jugar mucho

4hoy miel estar triste

5porque juanito estar muy ocupado y no puede jugar

6ser

7estar

8ser

9estar

10estar

1ser

2estar

3ser

4ser

5ser

6estar

7ser

8ser

9ser

10ser

11estar

12ser

Explanation:

Rewrite the sentences using direct object pronouns.
1.​ ​Yo entrego la tarea todos los días.
2.​ ​Ellas venden sus libros de texto cada semestre.
3.​ ​Los perros rascan las pulgas.
4.​ ​Mi abuelo busca a mi abuela.
5.​ ​Los niños llevan pasteles a la clase.
6.​ ​Los elefantes comen el heno.
7.​ ​Yo voy a comprar una computadora.
8.​ ​Ella dice la verdad siempre.
9.​ ​Nosotros leemos las novelas de ciencia ficción.
10.​ ​Mi hermana toma tres aspirinas cada día.
11.​ ​Mis padres miran dos perros.
12.​ ​Nosotros buscamos fruta en el mercado.
13.​ ​Tú vas a devolver los libros a la biblioteca.
14.​ ​Nosotros vamos a tomar un examen mañana.
15.​ ​Yo necesito las llaves.
16.​ ​Mis tíos compran una casa nueva.
17.​ ​Yo puedo oír la mùsica.
18.​ ​Yo pinto la pintura.

Answers

Answer:

1- Yo la entrego todos los dias

2- Ellas los venden cada semestre

3- Ellos se rascan las pulgas

4- Mi abuelo la busca

5- Ellos llevan pasteles a la clase

6- Ellos comen el heno

8 - Ella la dice siempre

9- Nosotros las leemos

10- Mi hermana toma 3 al dia

11- Mis padres los miran

12- Nosotros buscamos en el mercado

13- Tu los vas a devolver

14- Nosotros lo tomamos mañana

15 - Yo las necesito

16- Mis tios la compran nueva

17 - Yo puedo oirla

18 - Yo la pinto

Explanation:

Let me know if i did it wrong , suerte :)

Other Questions
If x+5=20, what does X+10 equal? What is mass? In matter and energy A student records a physical property of a rock as 2.2N. Which physical property has the student measured? What does Beowulf foresee concerning Freawarus marriage Carbon decays every 5700 years. If you found a rock containing Carbon that has gone through 2.5 half lives, how old is that rock? Love after Love By Derek Walcott What are machines fueled by?1. Energy 2. Electricity only3. gasoline only4. Sun You measure containers for international shipments. The height of the standard container is 6 feet and 7 inches. What is the height in meters? TIME REMAINING52:45The robotic rover Curiosity has instruments that detect radiation both inside the spacecraft and in the Mars environment. What is most likely the purpose of this radiation detection?to determine whether human exploration of Mars is possibleto develop better X-ray technologyto find evidence of once-living Martian microorganismsto investigate evidence of hydrogen and water (1/3)^2=? I need help with math I'm failing, because of my teacher By finding out who Figaro's parents are how does this inconvenience the Count? Starting from rest, a car travels 18 meters as it accelerates uniformly for 3.0 seconds. What is the magnitude of the car's acceleration? A. 6.0 m/s2 B. 2.0 m/s2 C. 3.0 m/s2 D. 4.0 m/s2 78There are 32 desks in a room.If x represents the number of rows of desks, which expression would equal the number of desks in each row?0 32 + x32 - xO 320 3/x Rafael can type 24 words in 6 minutes. What is his rate in words per minute what happen when two light waves traveling from oppsite direactions meet? if a doctor states that a patient has a bone break in the left anterior portion of their body, lateral to midline in their thoracic cavity, what can you assume im broken? In the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?A. TATTCATTCATTATGATTTATTCGB. TATTCATTGTTATGACTTTATTCGC. TATTCATTGTTATGATTTATTGGCGD. TATTCATTGTTATGATATTCGE. TGCATTCATTGTTATGATTTATTCG Which changes resulted from industrialization in the United States in the late 19th and early 20th centuries?A) increased number of people living in urban areasB) less crowded citiesC) more efficient farm production as machines replaced human laborD) decreased immigration from other countriesE) shift from a predominance of agricultural workers to a predominance of factory workers PLEASE HELP ME ANSWER AS MUCH AS YOU CAN I ONLY HAVE 3 POINTS LEFT AND IM TIMED. PLEASE TELL ME THE NUMBER AND LETTER. THANK YOU!!!!!!!!!!!1. Read the excerpt from a students report.I was honored to be a part of an online group of students from the United States, Africa, and China seeking solutions to water shortages. While we all had great enthusiasm about changing the world, the project quickly dissolved because no one was willing to listen to differing viewpoints.Which line could be added to show the difference a digital leader can make? A. We agreed as a group to spend some time studying each others country and meet again at a later date. B. We saved the project by allowing each group to share their thoughts and then chose the best solutions.C. We decided to disband and seek solutions with students from other countries who shared our viewpoints. D. We thought it would be best to stop meeting until our cultural differences can be addressed._______________________________________________________2. Electronic medical charts make it easier for doctors to A. share information on patients with other doctors. B. share information on patients with the government.C. communicate with patients about medical issues.D. track infectious diseases through a database.______________________________________________________3. Which is the best example of collaboration in a digital environment?A. Students meet in-person at a local library.B. Students work together on a project from a distance.C. Students work independently on a project from a distance. D. Students meet in a classroom to research a project._______________________________________________________4. In addition to talking to other doctors remotely, telehealth technologyA. allows patients and doctors to talk online.B. gives doctors the ability to keep people healthier.C. eliminates the need for doctors to see patients. D. allows patients to self-diagnose using the Internet. Exchanging goods or services of equal value is called (blank)(blank) replaces the need for bartering.Money allows us to exchange (blank) for goods and services. Steam Workshop Downloader