The unicellular organism sulphur bacterium is autotrophic, lives in a sulphur lake and is asexual. Can you describe its behaviours and features and classify it in the correct domain?

Answers

Answer 1

Answer:

bacteria

Explanation1 Bacteria. 2 Protists. Lab Comparing Algae and. Protozoans. 3 Fungi ... ways, and they can describe some of the internal structures of organisms related to ... Structure and Function Bacteria cells are ... Most eubacteria have been classified and identified based ... their lives as one-celled organisms and part of their lives as.

Missing: behaviours ‎| Must inclu:


Related Questions

In Amish populations, we see a much higher amount of a specific type of dwarfism compared to the rest of the human population. Which term is best applies to this situation?




Both of these

Genetic Drift

Founder Effect

None of these

Answers

Answer: Both of these

Explanation: trust me

All of the animal and plant populations living in a particular area make up a ____.
A. population
B. community
C. habitat

Answers

Answer:

A) population

Explanation:

Answer:

A. population

Explanation:

for example, you may see the population of a town, right? different segments of nature make up what i like to call "wild life towns"

for example, on a map, you may see population of a certain species for square mile.

For predation to occur, there must be a predator species and a prey species. Define predator and prey and give an example of each.

Answers

A predator is a carnivore animal that preys on prey animal. Prey animals are usually small herbivores or just smaller animals. Examples, lion and gazelle, bear and salmon, wolf and deer.

Nondisjunction that occurs during meiosis II produces what?

Answers

Answer:

Both of these daughter cells will then go on to divide once more in meiosis II, producing 4 daughter cells, 2 with n+1 and 2 with n-1. Nondisjunction in meiosis II results from the failure of the sister chromatids to separate during anaphase II.

PRODUCT
OR
11. (Circle one) Oxygen is a
released?)
REACTANT
of respiration? (In other words, is it needed or

Answers

Answer: ?

Explanation:

Describe one method to reduce the air pollutants released from a coal burning power plant

Answers

Answer:

A method to reduce the air pollutants released from a coal burning power plant is carbon capture.

Explanation:

Carbon Capture: It separates CO2 from emissions sources and recovers it in a concentrated stream. The CO2 can then be injected into the soil underground for permanent storage, or sequestration. Reuse and recycling can also reduce the environmental effects of coal production and use.

WILL MARK BRAINLIEST
Part A: Design a food chain with four trophic levels, and identify the organism in each level. What happens to energy as it travels from the bottom up? (3 points)
Part B: Can humans ever occupy the lowest, or first, trophic level? Why or why not? (1 point)

Answers

Answer:

Part A: Primary producer - plants (ex: sunflowers), Primary consumers- herbivores(ex: rabbits), Secondary consumers - omnivores and carnivores (ex: snake), tertiary consumers - omnivores and carnivores (ex: foxes), A-p-e-x predators - can be omnivores or carnivores (ex: coyote)

Energy decreases as it travels from the bottom of an energy pyramid, every time energy passes from one tropic to another, the predator only gets 10% of the total energy, or the stored energy, the rest of the energy has already been used up.

Part B: Humans cannot ever occupy the lowest or first tropic level, because the first tropic level is for producers like plants, humans are not producers and therefore cannot be at the first tropic level.

Shawn explains that many studies have shown that directly spraying bees with fungicides doesn't harm them. Are those results consistent with what Shawn has discovered? Explain your answer in a few sentences.

Answers

Answer:

Yes.

Explanation:

Yes, the results will be consistent of spraying bees with fungicides because the fungicides affect the growth of fungus not the bees. fungicides  are the chemicals kills fungal growth while on the other hand, insecticides will kill the insects such as ants, bees etc. If the Shawn apply insecticide on the bees, it will kill the bees due to its effectiveness so that's why the results of the directly spraying bees with fungicides will always be consistent due to its ineffectiveness.

PLSSS HELP WITH THIS IMMEDIATELY!!!!! only answer if u know, i’ll be giving brainiest to the right answert

Answers

Answer:

I cant see the question just use the snipping tool to tack a screenshot

Explanation:

I don’t have a lot of time please help!
No websites or links.

Don’t answer it if you don’t now. Thanks

Answers

ANSWER: KR or Krypton has 36 protons

how we know that is because the atomic number of an element will ALWAYS be the same number of protons

for example if we have atomic number 79 for AU or gold then that tells you gold will have 79 protons

hope this makes since and helps :)

What processes can increase the amount of atmospheric CO2?

Answers

Answer:

Explanation:

Carbon dioxide is added to the atmosphere naturally when organisms respire or decompose (decay), carbonate rocks are weathered, forest fires occur, and volcanoes erupt.

Carbon dioxide is also added to the atmosphere through human activities, such as the burning of fossil fuels and forests and the production of cement.

Answered by the One & ONLY #QUEEN aka #DRIPPQUEENMO

Hope This Helped !! :)

Human-induced emissions from fossil fuels contribute a relatively small amount of the increase in atmospheric CO2Deforestation and forest degradation reduces the removal component of this cycle, further increasing the carbon dioxide in the atmosphere

genes for traits that help an organism be more successful reproductively can be expected to ...

A - cause it to evolve into species

B - eventually be eliminated by natural selection

C - become more common in the future

D- cause the extinction of the species

Answers

C - become more common in the future

Which part of a DNA molecule is responsible for the direct coding of specific traits in an organism?

Answers

Answer:

i dont know i need points

Explanation:

Cross a heterozygous axial, hybrid round seed plant with a hybrid axial, heterozygous round seed plant. Only list the phenotypic ratio at the end.

Answers

Answer:

The phenotypic ratio is 9:3:3:1

9/16 individuals with axial flowers and rounded fruits, R-A-3/16 individuals with terminal flowers and rounded seeds, R-aa3/16 individuals with axial flowers and wrinkled seeds, rrA-1/16 individuals with terminal flowers and wrinkled seeds, rraa

Explanation:

We need to cross a heterozygous axial, hybrid round seed plant with a hybrid axial, heterozygous round seed plant. When referring to a hybrid plant for a trait, we are meaning that the plant is heterozygous for that trait.

Let us assume that round is the dominant trait, codified by a diallelic gene, so

R is the dominant alleler is the recessive allele

Let us also assume that axial is the dominant trait, so

A is the dominant allelea is the recessive allele    

Cross:

Parentals)   RrAa  x  RrAa

Gametes)  RA, Ra, rA, ra

                 RA, Ra, rA, ra

Punnett Square)     RA           Ra          rA          ra

                   RA      RRAA    RRAa      RrAA     RrAa

                   Ra      RRAa     RRaa       RrAa     Rraa

                   rA       RrAA     RrAa       rrAA      rrAa

                   ra       RrAa      Rraa        rrAa       rraa

F1) Among the progeny, we expect to observe the following phenotypic ratio:

9/16 individuals with axial flowers and rounded fruits, R-A-3/16 individuals with terminal flowers and rounded seeds, R-aa3/16 individuals with axial flowers and wrinkled seeds, rrA-1/16 individuals with terminal flowers and wrinkled seeds, rraa

И a whole

The cell of
an elephant will be not be larger than that of an ant give reasons?​

Answers

The cell of an elephant will not be larger than the cell of an ant because the size of an animal cell is more or less the same in every animal cell. ... For example, the size of muscle cell and the size of nerve cell will differ from one another because of their function rather than the animals in which they are found.

Answer:

Explanation:

The cell of  an elephant will be not be larger than that of an ant.

This is because the shape and size of the cell does not depend on the body of the organism but on the function that the cell performs.

So the cell of the elephant will not be larger than that of an ant.

Hope it helps!

Please mark as brainliest!

Can someone name and explain each lymph organ?

Answers

Answer:

The lymphatic system consists of all lymphatic vessels and lymphoid organs. For example, the lymph nodes, spleen, thymus as well as the lymphatic tissue found in the small intestine (Peyer’s patches) and throat (adenoid tonsils, palatine and tubal tonsils), to name a few, all represent lymphatic organs.Hence, rather than representing a single organ, the lymphatic system comprises a circulatory network of vessels and lymphoid tissue and cells in every part of the body. It works together closely with the blood-producing (haematopoietic) system in the bone marrow, thereby playing a vital role in immune responses to protect the body from various pathogens. Also, the lymphatic vessel network helps transporting nutrients and waste products in the body.

Answer:

please follow me

Explanation:

yr60zpzyoy9yit*fiif7rrr

Describe how the picture below represents the function of the immune system

Answers

Answer:

The Human Immune system helps fight bacteria and germs and viruses because without the Immune system we could die it is what protects us from The flu and sometimes cov id with a weak immune system we might no survive.

Explanation:

How are primary and secondary ecological succession similar?

1 Both types of succession require the same amount of time to occur.
2 Both types of succession result in greater biodiversity over time.
3 Both types of succession decrease the stability of an ecosystem.
4 Both types of succession have the same starting conditions.
5 Both types of succession eventually lead to a community closer to equilibrium.

Answers

Answer:

I don't know

Explanation:

I don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowI don't knowHow are primary and secondary ecological succession similar?

1 Both types of succession require the same amount of time to occur.

2 Both types of succession result in greater biodiversity over time.

3 Both types of succession decrease the stability of an ecosystem.

4 Both types of succession have the same starting conditions.

5 Both types of succession eventually lead to a community closer to equilibrium.

Hold on, our servers are swamped. Wait for your answer to fully load.

Someone’s help me please

Answers

Answer:

trailmix

Explanation:

Mary pushes her cart across the floor with a force of 150N for a distance of 10m. What is the work done on the cart?

Answers

Answer:

1500Joules

Explanation:

Work done, denoted by W, can be calculated using the formula:

Work done (W) = force (F) × distance covered (d)

According to the information in this question, Mary pushes her cart across the floor with a force (F) of 150N for a distance (d) of 10m.

Hence, work done (W) by the cart is:

W = 150N × 10m

W = 1500 Newton.metre (N.m) or Joules (J).

Is this person male or female? Why? :l

Answers

Answer:

I think Female because hey aren't any Y chromosomes

hope this helps

have a good day :)

Explanation:

c) Explain why wheat is not able to grow well in
nitrate poor soil.

Answers

Answer:

When soil available nitrogen is low, yield and protein content will be low. As nitrogen is applied beyond these levels the wheat plant will no longer use it to

Why does a mountain create a rain shadow on the other side of a mountain?

Answers

Answer:

I hope this will help u

Explanation:

A rain shadow is a dry region of land on the side of a mountain range that is protected from the prevailing winds. ... As the air rises up over a mountain range, the air cools, water vapor condenses, and clouds form. On this side of the mountains, called the windward side, precipitation falls in the form of rain or snow

In a sample of double stranded dna if 19% of the nitrogenous bases are guanine what percent of the nitrogenous bases are adenine

Answers

Answer:

31%

Explanation:

Chargaff's law says the amount of A (adenine) = T (thymine) and G (guanine) = C (cytosine). If

G = 19% then C= 19%

19% + 19% = 38%

100% - 38% = 62%

62% for A and T

Divide by 2 and you get

31%

what is the complementary DNA of TACCGGATGCCAGATCAAATC?

Answers

Answer:

ATGGCCTACGGTCTAGTTTAG

Explanation:

A=T

C=G

G=C

T=A

This is the key to finding a complementary DNA strand.

REPLY ASAP what's the main function of red blood cells, white blood cells, platelet and plasma?

Answers

Answer:

carries the blood components throughout the body

Explanation:

plasma is the largest part of your blood.

List 4 characteristics of Animals.

Answers

Answer:

animals

Explanation:

The Animal Kingdom

Animals are multicellular.

Animals are heterotrophic, obtaining their energy by consuming energy-releasing food substances.

Animals typically reproduce sexually.

Animals are made up of cells that do not have cell walls.

Animals are capable of motion in some stage of their lives.

Biodiversity
8
A farmer who owns a large fruit orchard has noticed that certain tree species in his orchard are failing to produce fruit and are slowly
dying. This has caused a decrease in the variety of fruit available for him to sell to consumers. Which of the following changes has
most likely caused this change in biodiversity?
OA
increased soil aeration due to an increase in earthworm populations
OB
decreased rainfall due to a prolonged period of drought
OC. decreased competition for space due to the removal of weeds
OD
increased pollination due to an increase in pollinator populations

Answers

Answer:

OA increased soil aeration due to an increase in earthworm populations.

Answer:

it is B. decreased rainfall due to a prolonged period of drought

Explanation:

trust me i got it right on my quiz

What were the old women doing?
In Percy jackosn

Answers

Answer:

If it is the scene that I think you're referring to, they were sitting in a group on rocking chairs, cutting yarn.

Explanation:

in Greek mythology, these women are the three Fates, named Clotho, Lachesis, and Atropos. In mythology, a thread represented someone's lifeline, and when the Fates cut your thread, it meant your life was over and you died.

In this specific scene, from The Lightning Thief, the Fates are seen cutting a blue piece of yarn, which makes Percy's friend Grover nervous because he believes they've just cut Percy's lifeline.

What organisms are capable of cellular respiration?

A. Heterotrophs only
B. Animals and fungus
C. Animals, fungus, and some bacteria
D. Protists
E. All organisms

Answers

the answer is E. All organisms
Other Questions
Which letter on the map indicates the location of China? 1. In paragraph 3, how does Lincoln use the topic of religion to convey his attitude toward the war?A. He argues that because war is so terrible, it is wrong to assume that God would favor either side in the struggle.B. He suggests that the cost of the war may be justified because it is an example of divine justice.C. He warns that the world will not end until God punishes the south for permitting the institution of slavery.D. He wonders if appeals for divine help would be more effective if the wars goal were to end slavery. PLEASE PLEASE HELP ILL GIVE U BRAINEST what is the midpoint of (0,0.55) and (-3,6) 25 POINTS AND BRAINLIESTThe sets of numbers 6, 8, 10 and 5, 12, 13 are Pythagorean triples. Use what you know about the Pythagorean Theorem and explain or show why they are Pythagorean triples. Be sure to show your work for each set of triples!YALL DONT GIVE ME A COLLEGE ANSWER TRY TO DUM IT DOWN THANKS! You and a friend are discussing how many sections you completed so far in algebra one you tell your friend I finish three times as many sections as you your friend replies youve only finished four more sections and I have how many sections have you and your friend completed A tidally locked moon orbits a planet every 88 days. How long does it take for that moon to rotate? Why? HELPPPP! The Senate has 100 members, ______ from every stateWhat goes in the empty slot? PLEASE HELP ME WITH THIS I ONLY HAVE 8 MINUTES I will give you extra points . THANK YOUU Umm I need some help pleaseeeeee What process is used to link amino acids together? PlEASE I REALLY NEED HELP PLEASE I BEG OF YOU PLEASE! PLEASE HELP (picture shown) who was responsible for developing confucianism 0.9x+20=830 Solve for X describe the structure of a typical metal such as iron ?assaaap the name of a group of peoplewho lived in the Southwest Desert Choose the correct form of comer to complete the sentence. Witch zone contains plenty of sunlight for photosynthesis why is it important to let dough cool before using it Steam Workshop Downloader