what type of pathogen causes malaria?

Answers

Answer 1

Answer:

Malaria is caused by the Plasmodium parasite. The parasite can be spread to humans through the bites of infected mosquitoes. Plasmodium falciparum is mainly found in Africa.

Hope this helped :)

Answer 2

Answer:

protists

Explanation:

Organisms that cause disease to humans are known as "pathogens." There are many different types of pathogens such as: bacteria, fungi, virus, parasitic worms and protists.

Malaria is caused by the following parasites: Plasmodium ovale, Plasmodium malariae, Plasmodium falcifarum and Plasmodium vivax. These parasites are also known as "protists pathogens." They are transmitted by the female Anopheles mosquito and are being transferred to humans through mosquito bites. The parasites then thrives in the red blood cells of the infected individual.


Related Questions

One danger of excessive nitrogen levels in water is BLANK.

Answers

Answer:

light

Explanation:

excessive nitrogen can harm water bodies excessive nitrogen can cause overstimulation of growth of aquatic plants and algae excessive growth of the organisms intern can clogged water intakes used to solve oxygen as they decompose and block light to deeper waters

What is the nervous system and how does it help you function? What structures are included in the human nervous system?

Answers

The nervous system is the major controlling, regulatory, and communicating system in the bodyThe nervous system plays a role in nearly every aspect of our health and well-being. It guides everyday activities such as waking up; automatic activities such as breathing; and complex processes such as thinking, reading, remembering, and feeling emotionsThe nervous system has two main parts: The central nervous system is made up of the brain and spinal cord. The peripheral nervous system is made up of nerves that branch off from the spinal cord and extend to all parts of the body.

In the water cycle, water returns to the ground as precipitation. How does phosphorus return to the soil in the phosphorus cycle?
A.
Phosphates found in soil dissolves in water.

B.
Phosphates are absorbed by the roots of plants.

C.
Animals eat the plants that absorbed the phosphates.

D.
Animals that ate the plants die and decompose.

Answers

Answer:

D

Explanation:

As you observe an unknown cell under a microscope, you make the following observations..

Answers

it is probably a plant cell because it has a cell wall and chloroplasts.

Answer:

It is a plant cell that is being observed

Explanation:

With in the cell, there are chloroplasts that ONLY a plant cell has. It also has a cell wall which an animal cell does not, so it is clearly not an animal cell.

Bones provide attachments that allow skeletal muscles to cause movements? True or false

Answers

Answer:

True ...........................

Peppered moths have learned to stay still (not move) on a tree trunk during daylight hours to avoid being eaten by birds. This is an example of...
A. Natural selection
B. Behavior adaptation
C. Structural adaptation
D. Selective breedeinh

Answers

Answer:

Behavior adaptation

Explanation:

Behavior adaptation is where a animal behaves in a different manner that suits its environment or keeps the animal safe

Does eukaryotic cells need more lipids than prokaryotic cells

Answers

Answer: yes because they need more energy

Explanation:eukaryotes are more complex than prokaryotes

Why are elements called
the building blocks of matter?
A. They stack up nicely.
B. They make-up all matter.
C. They make-up most of the matter around us.

Answers

Answer:

B

Explanation:

B. They make up all matter

When writing experimental results, be sure to ALWAYS
A)
include the equipment used
B)
include any mistakes you made
include appropriate units on any mathematical results
D
include the names of the people who performed the lab experiment

Answers

Answer:

All of the above

Explanation:

Should include any equipment that you would need to use. Since it is an experiment you should include any mistakes you made during the experiment.

please help me Which example is a trace fossil?

dinosaur footprint


dinosaur bone


dinosaur egg


shark tooth

Answers

Dinosaur egg would be your answer.

Answer:

Dinasour footprint

Explanation:

6 grade science


Please help me with this and answer correctly.
Brainliest will give!! ​

Answers

Answer:

Sorry can't help

Explanation:

PLEASE GIVE ME BRAINLIEST

In non-mendelian genetics, humans have 4 blood types in which A and B are codominant and o is recessive. I cross two parents with type AB blood. What is the percentage of children with type B blood?

A. 0%
B. 25%
C. 50%
D. 100%

Answers

Answer:

i think it may be 50 dont be mad if im wrong

Explanation:

recessive takes over from what i read i dont see any o so it can be half a half b so 50...

when using a solar powered calculator what source of energy is being used to power the calculater

Answers

Answer:

UV rays

Explanation:

Solar energy and solar rays is what powers the calculator

What is a niche, and how does it relate to evolution?

Answers

Answer:

The evolution of species’ niches is a process that is fundamental to investigations in numerous fields of biology, including speciation, community assembly, and long-term regional and global diversification processes. It forms the nexus between ecological and evolutionary questions. Topics as diverse as ecological speciation, niche conservatism, species coexistence, and historical biogeography all rely on interpreting patterns and drivers of species’ niches through time and across landscapes. Despite this importance, a distinct research agenda concerning niche evolution as a discrete topic of inquiry has yet to emerge. Niche evolution is often considered as a sidebar or of secondary importance when addressing questions such as “how did two species diverge?” Basic questions such as “what is a niche,” “what is the biological basis of niche evolution,” “at what scale should we evaluate niche evolution,” and “how can we observe niche evolution at different timescales” have rarely been addressed directly, or not at all in some systems. However, various intellectual threads connecting these ideas are evident in a number of recent and historical publications, giving some semblance of form to a framework for interpreting and evaluating niche evolution, and outlining major areas for future research from an evolutionary perspective. There is a reverse perspective from the macroecological scale as well, with questions involving coexistence, distributions and ranges, food webs, and other organismal attributes

Explanation:

ye

plzzz help i willl give you a Brainliest if you get it correct

Most scientists come up with questions to investigate out of the blue.

1.true

2. false

Answers

The answer is False

Answer:

the correct answer is false.

The spinal cord relays messages between the body and the brain. These messages control body functions like movement, bladder and bowel control and breathing. Each vertebra has a pair of spinal nerves that receive messages from the body (sensory impulses) and send messages to the body (motor impulses). The spinal nerves are numbered 1 to 55 from the neck down. The first eight as seen here are the vertebrate and send messages to the back of the head, neck, shoulders, arms, hands and diaphragm. A) cervical B) lumbar C) sacral D) thoracic​

Answers

The Correct answer is C

the process of which cells make proteins is called protein what?

this is a fill in the blank!

Answers

Answer:

protein biosynthesis

Explanation:

prove me wrong

Answer:

any of a class of nitrogenous organic compounds that consist of large molecules composed of one or more long chains of amino acids and are an essential part of all living organisms, especially as structural components of body tissues such as muscle, hair, collagen, etc.

Explanation:

what are the two main organs involved in the respiratory system?​

Answers

Answer: The respiratory system is the network of organs and tissues that help you breathe. It includes your airways, lungs, and blood vessels. The muscles that power your lungs are also part of the respiratory system.

Explanation: Your respiratory system is the network of organs and tissues that help you breathe. This system helps your body absorb oxygen from the air so your organs can work. It also cleans waste gases, such as carbon dioxide, from your blood. Common problems include allergies, diseases or infections.

What is the respiratory system?

The respiratory system is the network of organs and tissues that help you breathe. It includes your airways, lungs, and blood vessels. The muscles that power your lungs are also part of the respiratory system. These parts work together to move oxygen throughout the body and clean out waste gases like carbon dioxide.

nose and lungs i think

this is a cell not a plant, because the cell do not contain________

Answers

Answer:

Chloroplast.

Explanation:

This is what I believe it is since we're obviously talking about an animal cell and NOT a plant cell like it says. Animal cells do not contain chloroplast.

If this is the answer you're not looking for, let me know! Hope this helped! :)))

Why is sickle cell anemia so harmful to its carriers?

Answers

Answer: BECAUSE IT MAKES THE RED BLOOD CELLS SHRINK

Explanation:

Answer:

Sickle cell anemia is harmful to the body because it is enagering your spleen and with less healthy red blood cells circulating in the body, you can become chronically anemic.

Sickle cell anemia puts your body at more risk for infection.

Explanation:

Replication, Transcription, and Translation Chart

Please answer


DNA Replication:

1。Template Strand: Start with this nucleotide chain.

TACCCTTGAATAAAAAATCTCTGTTTGGTCGGTATTGTTGAAATC



2。Complementary DNA Strand: Write directly below template strand.


Transcription:

3。mRNA Strand: Write the complementary mRNA strand from the DNA template strand (#1).



Translation:

4。Anticodon: Write the anticodon sequence to match the mRNA strand (#3).



5。Protein Synthesis: Write the mRNA sequence that is complementary to the anticodons. Meaning the opposite code of the anticodons (#4).



6。Amino Acid Sequence: Create the amino acid sequence from protein synthesis using 3 letter abbreviation for amino acids (#5).

Answers

Answer:

jnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn

Explanation:

Choose all the answers that apply.
Binary fission _____.
is the type of reproduction used by bacteria
occurs in organisms that do not have a membrane bound nucleus
is a type of sexual reproduction creates identical copies of the parent cell
is a type of asexual reproduction

Answers

Answer:

A, B, D

Explanation:

Binary fission occurs primarily in prokaryotes, but can occur in eukaryotes. It is used by bacteria and is asexual reproductio, not sexual.

Explanation:

occurs in organisms that do not have a membrane bound nucleus. Explanation: Binary fission is an asexual mode of reproduction. As it does not involve formation and fusion of gametes.

Adaptations of plants in different climatic conditions in Telangana

Answers

Explanation:

Note, Telangana is known to be an area whose climate is usually semi-arid, that is, it is an area that is dry and receives some small amount of rain.

Thus, plants in the Telangana region would usually possess  the following adaptive features;

ability to survive under extreme heatgrowing longer roots than normal in other to find water in the soilefficient water conservation especially in their stems.

What is the function of cholesterol?

to keep the cell membrane from falling apart
to line the arteries of organisms
to store energy
to give us quick energy

Answers

Answer:

to store energy

Explanation:

Its main function is to maintain the integrity and fluidity of cell membranes and to serve as a precursor for the synthesis of substances that are vital for the organism including steroid hormones, bile acids, and vitamin D. Cholesterol is essential for making a number of critical hormones, including the stress hormone cortisol. Cholesterol is also used to make the sex hormones testosterone, progesterone, and estrogen. 2 The liver also uses cholesterol to make bile, a fluid that plays a vital role in the processing and digestion of fats.

What is the value of the expression 3 divided by 3/4

Answers

Answer:

4

Explanation:

If we have the expression, 3/3/4.

Then this is the same as 3 × 4/3

Which is the same as 12/3

Which is the same as 4

Hence the value of the expression 3/3/4 is 4

At the beginning of the film, director Ron Howard shows two contrasting scenes: The deaths of the Apollo 1 crew and a party celebrating the landing of Apollo 11 on the moon. How do these scenes foreshadow the rest of the movie?

Answers

Answer:

It foreshadows that the Apollo 11 made it to the moon, while Apollo 1 did not

Explanation:

Which of the following is NOT produced by
respiration
sugar
Ds ATP energy
carbon dioxide
water

Answers

Answer:

I think its water or sugar.

I NEED HELP

1. What are chromosomes?
2. What are the four phases of mitosis, in the correct order?
3. In what phase of mitosis are chromosomes moving toward opposite sides
of the cell?
4. Compare the two nuclei that form as a result of mitosis?
5. What is cytokinesis, and when does it occur?

Answers

Answer:

1. a chromosome is a dna strand that has genes

2. prophase, metaphase, anaphase, telophase

3. anaphase

4. the two nuclei are identical daughter cells and they have the same number of chromosomes

5. this is when the cell separates forming two new daughter cells and it occurs in the late telophase of mitosis.

sorry if this is wrong but this is how i learned it! hope it helps!

Explanation:

1. Even though the atom is made of charged particles, it is still neutral Explain why. (1 point)

Answers

Answer:

An atom is electrically neutral (overall charge is zero) since the total number of protons is equal to the total number of electrons.

Hope this answered your question :)

I will mark brainest if you get it right
A photovoltaic cell captures ____ to be used for power.
A. Wind
B. Water
C. Coal
D. Sunlight

Answers

Answer:

D. Sunlight

Explanation:

Answer:

santa claus

Explanation:

Other Questions
President Obama repeats the phrase "Students who sat where you sit ..." Why does he include this phrase? How does it add to the meaning of this excerpt? Use evidence from the text. When Branch Rickey confronted Jackie with his character flaw, how did Jackie respond?..............................................................................................................................................................................................................................................................................................................................................He refused to change because he was being mistreated.He told Rickey that he could not change, because that was just part of who he was.He reassured Rickey that people would eventually accept him because he was a great athlete, in spite of his flaw.He agreed to work hard to control his outbursts of temper.He stopped being friends with Rickey, but did as he suggested. Polynomials-AlgebraLet f(x) and g(x) be polynomials as shown below. (See picture)Which of the following is true about f(x) and g(x)? A. f(x) and g(x) are not closed under subtraction because when subtracted, the result will not be a polynomial. B. f(x) and g(x) are not closed under subtraction because when subtracted, the result will be a polynomial. C. f(x) and g(x) are closed under subtraction because when subtracted, the result will be a polynomial. D. f(x) and g(x) are closed under subtraction because when subtracted, the result will not be a polynomial. what is the lmc of 12 and 15 Please help!!!! 8th grade math The Langleys spend 40% of their monthly income on rent. If their monthly income is $4,400, how much money do the Langleys spend on rent? Help please. hi A paragraph on bahrain national day lights This Christian kingdom teamed with the Christian kingdom of Castile to begin the Reconquista of the Iberian Peninsula.Question 41 options:BastilleSevilleAragonKhagan How can exponential growth be used to make predictions? 2. What is an example of personification? * Solve for x using thedistributive property.3(-3 - 3x) = 27 HelpPlease help find b Solve the Equationx + 8 + 3x = x 6A. x = 18B. x = 14C. x = 2D. x = 4 Find the area of the regular polygon. Round to the nearest tenth. name at least three states that do not have many private or public forest. PLEASE HELP ASAP! PLEASE HELP! Write the correct definite article in the space. 1. _____ manzana 2. ______ bota 3. _______ gato 4. _______ caballo 5. _______ vaca! ! 6. _______ conejo 7. _______ pajaro 8. _______ gordo 9. _______ amigo! ! 10. _______ pluma 11. _______ medico 12. _______ palo 13. ______ plumas! ! 14. ______ perros 15. ______ cuerpos 16. ______ gatas 17. ______ amigas! ! 18. ______ nutrias 19. ______ hombres 20. ______ mujer Write the correct indefinite article in the space. 1._______ manzana 2. _______ bota 3. _______ gato 4. _______ caballo 5. _______ vaca! ! 6. _______ conejo 7. _______ pajaro 8. _______ gordo 9. _______ amigo! ! 10. _______ pluma 11. _______ medico 12. _______ palo 13. ______ plumas! ! 14. ______ perros 15. ______ cuerpos 16. ______ gatas 17. ______ amigas! ! 18. ______ nutrias 19. ______ hombres 20. ______ mujer Help plsWhat is the significance of the 1764 Treaty of Niagara for First Nations? What is its significance for Canada today? is it normal that you can make your eyesight blurry whenever you want to all by yourself and then make it go back to normal? PLS HELP ! 100 POINTS!!!!! Select the correct answer. This graph represents a quadratic function. What is the value of a in the functions equation? The nation of Pineland forbids international trade. In Pineland, you can buy 1 pound of fish for 2 pounds of pineapples. In other countries, you can buy 1 pound of fish for 1.5 pounds of pineapples. These facts indicate that Steam Workshop Downloader