Which diagram best illustrates why theories can be changed or replaced?

Which Diagram Best Illustrates Why Theories Can Be Changed Or Replaced?

Answers

Answer 1

Answer:

I think the answer is second one


Related Questions

Can anyone name all these parts of the microscope? please label each part with the number on the picture.

Answers

Answer:

Explanation:

Earth's outer core is made of_____.

A. solid rock

B. liquid rock

C. solid metal

D. liquid metal

Answers

Answer:

Liquid metal.

Tell me if wrong. :) Hope it helps!

Explanation:

Answer:

A) No problem

Explanation:

solid rock

Answer for brainliest answer

Mutations that occur _____ can affect offspring

1. During mitosis

2. During meiosis

3. In replicated dna

4. In body cells

Answers

Answer:

2. During meosis

Explanation:

During meosis mutations affect offsprings

Question 2
In this part of the experiment, you’ll prepare and test three milk solutions: milk and water, milk and lactase enzyme, and milk and heated lactase enzyme.

Prepare

Use masking tape to label the three beakers: “milk,” “lactase solution,” and “heated lactase solution.”
Measure 60 milliliters of milk in the graduated cylinder (or ¼ cup of in a measuring cup. Pour it into the beaker labeled “milk.”
In the beaker labeled “lactase solution,” add one lactase tablet and 100 milliliters (or 1/2 cup) of cool or room-temperature water. Use the stirrer to dissolve the lactase tablet in the water.
Add 100 milliliters (or 1/2 cup) of milk to the microwaveable container. Dissolve a lactase pill in the container. Put the solution in the microwave and heat it to boiling (about 2 minutes). Use oven mitts to remove the container. Pour the heated lactase solution into the beaker labeled “heated lactase solution” and let it cool.
Stay safe! Be careful while handling the boiled mixture to avoid spilling it on your hands.

Test

While you’re waiting for the lactase solution to cool, read the directions on the test strips. The test strips in the Edmentum lab kit will react to glucose within a few seconds. If you use different strips, the reaction time may vary. Now follow these steps to test the solutions. Record your data in the answer space.

Milk and water solution: Fill the first test tube one fourth full of milk. Fill the small graduated cylinder with water and gently add it to the milk in the test tube until the test tube is half full. Use the stirrer to thoroughly mix the solution. Then insert the test strip for 10 to 20 seconds. Look at the test strip, and record whether it changed color. Wash the stirrer.
Milk and lactase enzyme solution: Fill the second test tube one fourth with milk and one fourth with the lactase solution. Use the stirrer to thoroughly mix the solution. Insert the test strip for 10 to 20 seconds, and record whether it changed color. Wash the stirrer.
Milk and heated lactase enzyme solution: Fill the third test tube with one fourth milk and one fourth of the heated lactase solution. Use the stirrer to mix the solution. Insert the test strip for 10 to 20 seconds, and record whether it changed color.
Note: Keep the lactase and heated lactase solutions for the next part of the experiment.

Wash the “milk” beaker, the test tubes, and the stirrer. If you used paper cups as an alternative, throw them away.

Answers

Answer:

The bacterium should stop production of lactase.

Explanation:

This is because the E. coli bacteria can degrade lactose, but lactose is not preferred as source of fuel or energy to glucose. If glucose is present, E. coli would preferably employ it over lactose as Glucose needs little process and minimal energy to degrade when compared to lactose. Although, if lactose is the major sugar that is present, the E. coli will have no option than to employ it as it's source of fuel or energy. The formation of lactase enzyme utilizes energy, which cannot be utilised in the presence of high level glucose.

This appears to be a set of instructions for a lab experiment involving testing different milk solutions with lactase enzyme.

What is lactase enzyme?

Lactase is an enzyme that breaks down lactose, a sugar found in milk and dairy products, into glucose and galactose. People who are lactose intolerant have insufficient levels of lactase, which can lead to symptoms such as bloating, gas, and diarrhea when they consume dairy products.

The experiment involves preparing three different solutions (milk and water, milk and lactase enzyme, and milk and heated lactase enzyme) and then testing each solution with a test strip to see if it changes color, indicating the presence of glucose.

The instructions also include safety precautions, such as being careful while handling the heated lactase solution. Finally, the instructions remind the reader to wash all equipment used in the experiment.

Some people may have lactose intolerance, which means that they do not produce enough lactase to break down lactose in their bodies, resulting in discomfort and digestive problems.

Learn more about Lactase at:

https://brainly.com/question/27612608

#SPJ3

Location X is next to Location Y and they are both much colder than Location Z. Which statement is most likely true? a Locations X and Z are at the poles. b Locations X and Y are at the poles. c Locations X and Z are at the equator. d Locations X and Y are at the equator. WILL MARK BRAINLIEST

Answers

B locations X and Y are at the poles

plssssss help me to answer this question.......
I will mark you brainliest (just answer it correctly) asap​

Answers

Answer:

Explanation:

There are five columns here; electronic configuration (electron distribution), number of shells, valence electrons (number of electrons on the outermost shell that can participate in bond formation), period number (on the periodic table) and group number (on the periodic table).

Aluminium-13 (₁₃Al)

This means Aluminium has 13 electrons and thus will have the properties below

Electronic configuration: 1s²2s²2p⁶3s²3s¹

Number of shells: From the electronic configuration written above, Aluminium-13 has 3 shells.

Valence electrons: The number of valence electrons (as seen in the electronic configuration - for the third shell) is 3.

Period number: Aluminium is found in period 3 because it has 3 electron shells

Group number: Aluminium is found in group IIIA because it has 3 electrons in it's outermost shell.

Calcium-20 (₂₀Ca)

This calcium atom has 20 electrons and thus have the following properties.

Electronic configuration: 1s²2s²2p⁶3s²3p⁶4s²

Number of shells: As seen in the electronic configuration above, calcium-20 has 4 electron shells.

Valence electrons: As seen in the electronic configuration also, the total number of electrons/valence electrons in the outermost shell is 2.

Period number: Calcium-20 is found in period 4 of the periodic table because it has four electron shells.

Group number: Calcium-20 is found in Group IIA of the periodic table because it has 2 electrons in it's outermost shell

Tin-50 (₅₀Sn)

This tin atom has 50 electrons and hence have the following properties

Electronic configuration: [Kr] 4d¹⁰5s²5p²

Where [Kr] is the electronic configuration of krypton atom

Number of electron shell: From the electronic configuration above, Tin-50 has 5 electron shells

Number of valence electrons: From the electronic configuration also, it has 4 valence electrons.

Period number: It is found in period 5 because it has 5 electron shells

Group number It is found in Group IVA because it has 4 electrons in it's outermost shell

Barium-56 (₅₆Ba)

Electronic configuration: [Xe] 6s²

Number of shells: 6

Number of valence electrons: 2

Period number: Period 6

Group number: Group IIA

Selenium-34 (₃₄Se)

Electronic configuration: [Ar] 3d¹⁰4s²4p⁴

Number of shells: 4

Number of valence electrons: 6

Period number: Period 4

Group number: Group VIA

What happens when an organism is eaten? A. All of its energy is returned to producers. B. All of its energy is gone when it dies and cannot be reclaimed by the ecosystem. C. A small portion of its energy is absorbed by the consumer, the rest is transformed into heat or waste. D. All of its energy is absorbed by the consumer.

Answers

Answer:

The higher organisms eat the lower organisms, break down their matter and rearrange the molecules to make their own matter. When any organism dies, the remains are broken down and put back into the cycle as inorganic molecules. Each of these organisms eat organic matter to produce energy and small pieces of matter.

2. A unique characteristic of the banyan tree is that roots grow down from its
branches into the ground. The tree can appear to have several trunks. What
advantage does this root characteristic give the banyan tree over other trees?
A. The roots provide shelter for ground-dwelling animals, which carry nutrients
to the tree.
B. The banyan can grow near the equator, because aboveground roots are
more protected from the sun.
C. The banyan can only grow in humid climates, because aboveground roots
are more likely to dry out and die during droughts.
D. The banyan can grow in areas prone to hurricanes and typhoons because
the roots make the tree more stable in high winds.

Answers

Answer:

D. The banyan can grow in areas prone to hurricanes and typhoons because

the roots make the tree more stable in high winds.

Explanation:

According to this question, banyan tree posseses a unique characteristic in which roots grow down from its branches into the ground making the tree appear to have several trunks. This type of root is called STILT OR PROP roots.

The major function of this stilt roots is to provide additional support for the plant during adverse conditions. Hence, a major advantage that this root characteristic give the banyan tree over other trees is that it confers resilience upon the banyan tree, making it able to grow in areas prone to hurricanes and typhoons because the roots make the tree more stable in high winds.

if you were standing in the path of totality,what type of eclipee would you see?

Answers

Answer:no

Explanation:

Because you could be blind

Answer:

You'd see a full eclipse.

Explanation:

The path of totality is the path that the umbra of the moon's shadow takes. It's relatively thin, as it's only 70 miles across, but if you stand in the path you will experience a full solar eclipse.

Drop a paper, a piece of thermopol, and a piece of plastic from a height of 10-15 feet. Note the time for each object to hit the ground. Why does the paper take more time than thermopol and thermopol more than the plastic piece? Make the paper to fell down in such a way that it should hit the ground before all of them. How did it happen? Explain.

Answers

It took the paper longer because is has a lot of surface area that air can resist to and push up, making it float slowly to the floor rather then drop quickly. The piece of plastic is also more aerodynamic than the piece of paper because the air wont have as much surface area to resist to.

We folded it into a paper airplane. We did this so that it will be more aerodynamic.

Correct me if I’m wrong.



It took the paper longer as it has quite a few surface places that air can withstand and push up, making it glide slowly to the ground rather than drop fast. The piece of plastic is likewise extra aerodynamic than the piece of paper because the air won't have as an awful lot of floor regions to face up to.

What is aerodynamic in simple terms?

Aerodynamics is the way air actions around matters. The guidelines of aerodynamics give an explanation for how an aircraft is capable of fly. whatever that movements through air reacts to aerodynamics. A rocket blasting off the launch pad and a kite within the sky react to aerodynamics. Aerodynamics even acts on vehicles, considering that air flows around motors.

What is an aerodynamic example?

Aerodynamics is the way air moves around matters. given that air is all around us, there are many examples of aerodynamic technology other than for aircraft. take a look at golf balls for instance. golfing balls have their unique shape with loads of dimples on them to improve their aerodynamics and create more lift.

Learn more about Aerodynamics at https://brainly.com/question/4702501

#SPJ2

Which defensive adaptation would best help a plant survive in an environment with leaf-eating animals?

A.
large fruits

B.
thick stems

C.
sharp thorns

D. colorful flowers

Answers

Answer:

C.  sharp thorns

Explanation:

The plants stand still, are not very physically active, and seem to be on the menu of many animals. Precisely because they cannot win at the first sign of danger, one has developed other ways in which they can defend themselves from annoying and dangerous animals.

Some have developed long thorns that repel attackers. Some have poisons that are very strong and because of which animals do not think of trying to eat that plant, but the defense of some plants seems to be well thought out and ready for all forms of attack.

If the mRNA is A T G G C G A G G C G G C A G C T G T T A T G G . What could be the tRNA?

Answers

UACCGCUCCGCCGCUCGACAAUACC

Atoms in covalent bonds _____ their electrons.

Answers

um i think it’s share but i’m not sure

Answer:

share

Explanation:

covalent bonds share electrons

ionic bonds transfer electrons

when a chicken with black feathers mates with a chicken with white feathers, their offspring may be a speckled hen. Half of a speckled hen's feathers are black and the other half are white. This is an example of:

A. multiple alleles

B. simple dominance

C. Codominance

D. incomplete dominance

Answers

i’m pretty sure it’s C. Codominance

Answer:

codominance

Explanation:

PLEASE HELP ME NOW!!!!!!!!!!!
(02.03 HC)
Examine the layers of rock. Identify and explain which layer contains the youngest fossils. (3 points)

Answers

Answer:

A

Explanation: A is the youngest bestie <3333

Answer:

A

Explanation:

Because it is at the top

What will most likely happen if the plankton population decreased in this ocean system?

Answers

Answer:

B since shrimp rely on plankton as a food source.

Explanation:

Shrimp feed on plankton if the population of plankton decreased the shrimp would have little to no food there for the population of shrimp would also decrease

Which pair of objects has the largest gravitational force?
a- car and bowling ball
b- marble and baseball
c- There is no gravitational force between any of these pairs of objects.
d-marble and can

Answers

Answer:a

Explanation: they are bigger they take up more space and heavier so the pull of gravity is stronger because of that

What roles do humans play in the carbon cycle?

Answers

Answer:

Humans affect the carbon cycle by burning fossil fuels and cutting down trees. Car exhausts and factory emissions produce a lot more CO2 in the atmosphere!

Explanation:

HOPE THIS HELPS:)

Answer asap

In what stage are humans learning essential skills like hunting, cooking and animal identification

Adult

Childhood

Adolescence

Infancy

Answers

Answer:

Adolescence

Explanation:

Given that infancy, age is the age of little children from the point of birth to about four years

Hence, this cannot be an answer.

Childhood is wrong because the childhood age is the age of 2 to 13. At such a tender age, one cannot go hunting due to fear of wild animals or have the capacity to learn to cook different food

Adult is also not correct because Adult age lies between 21 to 40 when middle age comes by. At this stage, one is expected to have at least basic skills to survive.

Therefore the correct answer is Adolescence. This is the age of 10 to 19. It is the last stage before Adulthood where one has to hone his basic and surviving skills. At this point, it is believed one has full mental capacity.

Answer:

Its Childhood don't listen to the other guy

Explanation:

I just got it right on my quiz

What is the function of epithelial cells?

Answers

Answer:

Pretty much everything that goes on inside ur body

Explanation:

Epithelial tissues are widespread throughout the body. They form the covering of all body surfaces, line body cavities and hollow organs, and are the major tissue in glands. They perform a variety of functions that include protection, secretion, absorption, excretion, filtration, diffusion, and sensory reception.

Will give brainliest to whoever gets it right at the end of my exam :))

Answers

Answer:

#3

Explanation:

NEED HELP VERY SIMPLE WILL MARK BRAINLIEST THANKS

Answers

Answer:

The organism

Explanation:

Answer:

last one and the second

Explanation:

Hypothesis: If the type of the food available
changes, then the frequency of beak types will
change, because birds with beaks more suited
to the available food will be more successful
over time.
The data of this lab
the
hypothesis because there was a difference in bird
beak distribution
DONE

Answers

answer:

supported, when fruit was removed

explanation:

the data of this lab supported the hypothesis because there was a difference in bird beak distribution when fruit was removed

the second question:

which possible outcome below would not have supported the hypothesis?

answer:

if generation 3 had flock distributions similar to those shown in the graph below

Hypothesis has to do  with the explanation that can be applied to a particular situation.

What is a hypothesis?

The term hypothesis has to do  with the explanation that can be applied to a particular situation. The hypothesis is often based upon a close observation.

The data is not shown here. However, the data does confirm or disprove a hypothesis as the case may be.

Learn more about hypothesis: https://brainly.com/question/10103458?

#SPJ5

1. Chantelle was given a sample of breakfast cereal to test for carbohydrates. (a) First, she decided to test the sample for glucose. Describe the test she should carry out and the results she might expect if glucose is present.

Answers

Answer:

The correct answer is - Benedict's solution for the test for glucose in food.

Explanation:

Benedict's solution is a test that is used to check if there is a presence of glucose in a food sample or not. It is possible due to the oxidation of the aldehyde present in the glucose turns to carboxylic acid in presence of the clear blue solution of sodium and copper salts or benedict's solution.

In presence of Benedict's solution the color of the sample turns yellow to orange with an increase in heat, however, the initial color of the solution is aqua blue.

Thus, the correct answer is - Benedict's solution for the test for glucose in food.

Elevated fibrinogen levels result in a(n) ___________, which increases the risk of a coronary or cerbrovascular incident.

Answers

Answer:

hypercoagulable state

Explanation:

Elevated fibrinogen levels result in hypercoagulable state , which increases the risk of a coronary or cerbrovascular incident.

A hypercoagulable state in medicine refers to a condition in which there is an abnormal increase in the tendency toward the clotting of blood also known as blood coagulation.

When fibrinogen levels are high, there is an increase in clot stiffness, increase in resistance of the clot to fibrinolysis as well as an increased blood viscosity.

I NEED HELP ASAP!!!! BRAINLIEST AND 50 POINTS!!!! Cycles in nature involve the recycling of matter. Which of the following processes is a key part of the water (hydrological) cycle? a
transpiration
b
combustion
c
photosynthesis
d
decomposition

Answers

Cycles in nature involve the recycling of matter the following processes is a key part of the water (hydrological) cycle the photosynthesis.

What is the importance of water cycle?

The water cycle is a critical ecological procedure that continues the share of water in the earth's ecosystem and ecosystems. The water cycle entails the cyclic motion of water from water our bodies and groundwater into the ecosystem via plants, which play a position in this cycle through photosynthesis and transpiration.

Photosynthesis in concerned withinside the water cycle as it helps transpiration and makes use of water as a reactant.

Read more about the hydrological:

https://brainly.com/question/5187046

#SPJ1

Which term is defined as masses of rock,earth and/or debris that flow downhill.

A.tsunami
B.aftershock
C.liquefaction
D.landslide

Answers

It would be a landslide.

Answer:

The term that defines masses of rock, earth and/or debris that flow downhill is landslide (option D).

Explanation:

When a landslide occurs, a certain amount of the mass of earth is detached or displaced downwards, due to the instability present in a certain area, especially when there is a slope in that land or slope .

The area that is unstable is usually in proximity to a stable ground zone, over which the slide occurs. The instability produced by the phenomenon is due to the fact that this ground has reached its maximum tangential tension.

In a landslide, the movement of rocks, debris and everything in the strip of land that slides can also be observed.

The other options are not correct because:

    A. Tsunami is the term for tidal wave, which impedes the displacement of large bodies of water, like waves, that reach the continent.

    B. Aftershock is the term that defines the seismic movements after an earthquake.

    C. Liquefaction of the earth implies that a compact terrain loses strength and becomes semi-liquid.

What are 2 things to all cells have?

Answers

Answer:

All cells have CYTOPLASM and DNA.

Explanation:

my answer got deleted.

explain why the statement below is incorrect
plants give off carbon dioxide into the air​

Answers

Answer:

plants don't give off carbon dioxide because they use carbon dioxide to make oxygen

Which fish species are the least tolerant of water pollution? Which fish species are most tolerant. how would you arrive at your conclusion?
Fishes used;
Bass
Carp
Gar
Catfish
Trout​

Answers

The fish that is less tolerant to water pollution is trout hope this helps :D
Other Questions
BRAINLIEST How did the SS enforce Nazi rule? Check all that apply.1. They targeted all opposition to Nazi rule.2. They killed anyone who refused to cooperate3. They had the power to arrest anyone for any reason 4. They asked people to turn in those who were against Nazi rule.5. They used terror, violence, and intimidation against people what is the value of the expression 2x^3 when x=-2 and y=3 What elements are involved in the Aerobic Respiration find measure of angle 2 if measure of angle 3 = 125 and measure of angle 4=23 Older adults don't suffer from body image problems because they are more accepting of who they are.Please select the best answer from the choices provided.TF How did technology change the world (HELP FAST)Which of the following always changes when a substance undergoes achemical change? please please fill in the blank ... and write division sentence i will mark you brainliest Evaluate the expression when m = 6 and n8.56+mn Jimmy and Alex each have a CD collection. The number of CDs in Jimmy's collection can be represented by x. The number of CDs in Alex's collection is 4 times the number in Walter's collection. The total number of CDs in both collections is 205. What is x, the number of CDs in Walter's collection? Question 3 of 8Which revision is needed to correct the following sentence?Just this once I'd like to see Aaron, and Emilio get a taste of their ownmedicineA Move the comma to after the word onceB. Add a comma after the word ASAc. Add a comma after the word EnhaD Move the comma to after the word and A club raised 175% of its goal for a charity. The club raises $875. What was the goal?Pls help and thank you The deltoid muscle can effectively contract through its entire ROM because of the upward rotation of the scapula, which serves to maintain tension in the deltoid muscle. If the deltoid loses tension, it becomes Determine whether PQ and UV are parallel,perpendicular, or neither.1.P(-3,-2), Q(9,1), U(3,6), V(5,-2)2.P(-10,7), Q(2,1), U(4,0), V(6,1)3.P(1,1), Q(9,8), U(-6,1), V(2,8)4.P(-4,0), Q(0,3), U(-4,-3), V(8,6)5.P(-9,2), Q(0,1), U(-1,8), V(-2,-1) Is (1, 3) a solution to the system of equations listed below? (1 point) y= 6x -3 y = x - 2 how many molecules are contained in 7.85 moles of oxygen molecules? How did the West African kingdoms become wealthy? Select the best answer from the choices below. a Agriculture b Gold and salt mining c Conquest d Trading with other empires Find the differenfe. -6-(-6) 5) Which statement best expresses the author's point of view in thispassage?A)The author sees social media networks as an entirelypositive aspect of culture.B)The author believes that using social media helpspeople improve their social skills.C)The author sees social media networks as an entirelynegative aspect of current culture.D)The author can see both positive and negativeaspects of social media use in culture today. Psychodynamic psychologists believe that behavior is aimed at satisfying conscious desires and wishes. Steam Workshop Downloader