If the mRNA is A T G G C G A G G C G G C A G C T G T T A T G G . What could be the tRNA?

Answers

Answer 1
UACCGCUCCGCCGCUCGACAAUACC

Related Questions

Why was miasma theory replaced?
O John Snow collected data that showed that germs cause disease.
O John Snow collected data that showed there was another cause to disease.
O New technology showed that miasma cannot exist.
O New technology showed that germs cause disease.

Answers

Answer:

Miasma theory was replaced because John Snow collected data that showed that germs cause disease.

Explanation:

The theory of miasma was proposed in the past when some scientists —like doctors Thomas Sydenham and Giovanni Maria Lancisi— thought that disease was the product of emanations originated by the decomposition of organic matter. This theory was based on the fact that diseases predominated in places with poor hygienic conditions.

John Snow, an english physician, was one of the main contributors to the microbial theory of disease. In 1854, while a cholera epidemic was occurring, he collected data and organized it statistically and then concluded that the disease was caused by germs present in drinking water. This data was contrary to the miasma theory, which would eventually be displaced by the microbial theory of the disease.

true or false Photosynthesis combines oxygen and carbon dioxide to make ATP.

Answers

False

Photosynthesis involvs plants taking in sunlight and carbon dioxide, not oxeygen and carbon dioxide. Oxygen is a byproduct of photosynthesis.

May I have brainliest please? :)

PLZ I NEED HELP!!!!!!!
Choose a Genetic Disorder from the list provided. Create a PowerPoint that includes ALL the information obtained from your research (questions). Please use rubric provided as a checklist to meet all requirements.

Answers

Hello there!

Albinism is a rare group of genetic disorders that cause the skin, hair, or eyes to have little or no color. Albinism is also associated with vision problems. According to the National Organization for Albinism and Hypopigmentation, about 1 in 18,000 to 20,000 people in the United States have a form of albinism. A group of inherited disorders characterized by little or no melanin production.

This condition increases the risk of skin cancer.

Most people with albinism have pale skin, eye conditions, and are sensitive to the sun.

No cure exists, but skin can be protected and eye conditions can be treated.

mostly men have it

Write the important of biology in our daily lives with respect to agriculture and industry

Answers

Answer:

Biology is an interesting subject that has been intriguing scientific minds for several centuries

Explanation:

Despite exponential developments in technology over the past few centuries, the origin of life on earth is still one of the biggest mysteries yet to be unraveled.

The basis of our very origin and existence on earth lies within the depths of the biological sciences. Biology has an endless array of species( at least as of now because there are an estimated 8.7 million species on earth out of which only 1.9 million species have been discovered, so there is a long way to go!).

Every creation which is a part of nature is so adorable and unique in its own way.

Biology exists every second - when we inhale and exhale each time, respiration is taking place within our bodies, each cell receives oxygenated blood and releases carbon dioxide and other excretory wastes.

Let aside other species, we haven't yet understood our own bodies completely!!How is it that our hearts work so tirelessly throughout our life span, how is it that we are able to interpret even minute emotions and gestures without even understanding the mechanism behind it!.How is it that each one of us is able to perceive things differently?What exactly is consciousness?..The list of questions seeking their answers is endless!

Biology helps us to sort things out and find answers to such questions.

Humans aren’t the only living things biology is concerned with. It also tells us all about plants and animals – how they live, what they’re made up of, and how they interact with mankind and each other. This enables us to make the most of our planet’s natural resources while trying to minimize the impact we have on the environment.

According to Jeffrey Gray, a British neuropsychologist, the behavioral inhibition system (BIS) is activated by danger signals ________, resulting in the experience of anxiety. a. within the amygdala only b. arising from both the brain stem and the cortex c. descending from the cortex d. ascending from the brain stem

Answers

Answer:

c. arising from both the brain stem and the cortex

Explanation:

The behavioral inhibition system(BIS) according to Jeffery Gray can be explained as neuropsychological system which gives the prediction of response from individual to signal of anxiety-relevant in a particular area or environment. He stressed that BIS have a relationship of sensitivity to punishment along with avoidance motivation. The The behavioral inhibition system is usually activated when individual is experiencing negative event/ stimuli, boring moments, or punishment. Then by the time the body respond to the cues of the negative stimuli involving punishment, then the (BIS) brings avoidance of the negative event. When there is activity of( BIS) then there will be heightened sensitivity to punishment as well as nonreward experience.

It should be noted that the behavioral inhibition system (BIS) is activated by danger signals arising from both the brain stem and the cortex resulting in the experience of anxiety.

How does lymph return to the circulatory system from the lymphatic system? (2 points)


1) It drains into a larger lymph node, which returns it to the subclavian veins.
2) It drains into a larger lymph trunk, which returns it to the subclavian veins.
3) It drains into a larger lymph trunk, which returns it to the subclavian arteries.
4) It drains into a larger lymph node, which returns it to the subclavian arteries.

Answers

Answer:

It drains into a larger lymph trunk, which returns it to the subclavian veins.

Explanation:

the second one is the correct answer, mark me brainliest if the answer is correct, thank you in advance :)

write 10 energy converters in our daily life along with their energy chains

Answers

Answer:

What are some examples of energy transformation?

The Sun transforms nuclear energy into heat and light energy.Our bodies convert chemical energy in our food into mechanical energy for us to move.An electric fan transforms electrical energy into kinetic energy.

Explanation:

Hope it is helpful....

EMERGENCY!!!!! Pregnant female bears do not go into deep hibernation in the winter like other bears. why might this be a physiological adaptation for mother bears?
a. the pregnant bear's metabolic rate would rise too high, and the fat stores would be gone quickly
b. the fat stores that bears building up in the summer and fall would be wasted on a pregnant bear
c. pregnant bears need to maintain a higher metabolism that nonpregnant bears
d. pregnant bears are unable to build up fat stores during the summer and fall moths.

Answers

Its is A because if the mother bear goes into hibernation pregnant with lets say 2 to 1 cubs the cubs will absorb all the nutrients the mother bear has and she will end up with none because her body is using up the fat and so are the cubs. So your answer is A

Answer:

c. pregnant bears need to maintain a higher metabolism that nonpregnant bears

Explanation:

I just did it

Flatworms can be cut in half, creating two new individuals, by _____.

fragmentation
binary fission
multiple fission
budding

Answers

Answer:

Fragmentation .

Explanation:

Answer:

Fragmentation

Explanation:

The process of fragmentation is indeed the process of breakage of an organism into various fragments that over time gets developed into a complete organism. Thus, this process is also referred to as the process of splitting.

An independent variable is:
A. Remain the same to make an experiment a fair test.
O B. Measured to show the effect of a change.
C. Collected to draw conclusions.
D. Changed to test a hypothesis.

Answers

The answer is a because it doesn’t change during an experiment

Answer:

The answer is (changed to test a hypothesis)

Explanation:

thats what the definition is

Andrew spent a day at the beach with his family and noticed thermal energy all around him. Which of the following best describes a type of heat transfer he may have experienced?​

Answers

Answer:sorry i don’t knowew

Explanation:

PLEASE HELP
"Watermelon snow" in Antarctica is caused by a species of photosynthetic green algae that thrives in subzero temperatures (Chlamydomonas nivalis). These algae are also found in high altitude in year-round snowfields. In both locations, UV light levels tend to be high. The reddish-pink color of these algae is due to the presence of carotenoid pigments, which absorb blue light while reflecting red light. Those pigments protect the chloroplast from ultraviolet radiation, as well as absorbing heat, which provides the algae with liquid water as the snow melts around it. This molecular variation in plants illustrates


A. relative fitness because the molecular adaptations in chlorophyll pigments have passed to the next generation

B. innate variability because plants have evolved molecular differences to an environmental stimuli

C. unselective adaptation because plants have evolved molecular differences to adapt to different wavelengths of light

D. inclusive fitness because differences in chlorophyll pigments increase the proliferation of beneficial traits in the population

Answers

The Answer is D

im not sure this is correct answer


If a mother is using drug during her pregnancy, her baby can be born with addiction syndrome towards the same drug. Explain.

Answers

Because all of the nutrients comes from the mother, and her umbilical cord. What ever mom put inside her body goes inside the baby’s body. It can also be in her breast milk. That’s why when your breast feeding you can’t drink.

Read the experimental design and answer the questions:
A group of students was trying to determine which type of soil would rose bushes grow the tallest in. They had five rose bushes that they planted in five different types of soil. The five bushes were all the same type and size in the beginning. The size of the pots were the same, they were watered the same amount and kept in the same light and temperature conditions.
a. What was the question and what was their hypothesis?
b. What was the independent variable?
What was the dependent variable? How do you think they measured it?
What conditions (variables) were controlled during the experiment?

Answers

Answer:

The question: Which type of soil would roses bushes grow the tallest in?

Hypothesis: One soil type would help the bush grow taller because each soil has different formulas while they were all water the same, got the same amount of sunlight, and kept at the same temperature.

Explanation:

Don't copy this exactly please, put it in different words because I didn't do well putting it together but there you go, lol.

Hope this helps!!!

a. The question the students were trying to answer was "Which type of soil would rose bushes grow the tallest in?" Their hypothesis was that one type of soil would lead to the rose bushes growing taller than the others.

b. The independent variable in this experiment was the type of soil in which the rose bushes were planted. The dependent variable was the height of the rose bushes. They likely measured the height of the bushes at regular intervals (e.g. daily or weekly) using a ruler or tape measure.

The conditions (variables) that were controlled during the experiment were the size of the rose bushes, the size of the pots, the amount of water, the light and temperature conditions.

What is a variable?

A variable is a characteristic or property that can take on different values or can be manipulated in an experiment or study. In science, variables are used to help understand the relationship between different factors or phenomena.

They can be classified as independent variables, which are manipulated by the experimenter, and dependent variables, which are observed or measured as a result of the manipulation of the independent variable. In some cases, there are also controlled variables which are kept constant in an experiment

Learn more about variables, here:

https://brainly.com/question/17344045

#SPJ2

can someone tell me the answers i need to turn this in asap?

Answers

Answer: 1. The population will increase because of the safeness. 2. Some animals might starve or become unhealthy because lack of resource. 3. A lot of animals will eventually die.

Explanation:

Good luck btw!!

I will mark brainest if you get it right
Sunlight, water, and wind are examples of inexhaustible forms of energy. What does inexhaustible mean?
A. We will run out at any minute.
B. We will run out in 100 years.
C. We will never run out.
D. We will run out in 20 years.

Answers

Answer:

c

Explanation:

C. We will never run out.

sooooooooooo can i get bralist

Inexhaustible means unlimited, so if inexhaustible means unlimited, the answer would be C.

What type of transport uses energy to move substances across the cell membrane

Answers

Answer:

it is called the active transport

Explanation:

primary active transport directly uses a source of chemical energy ATP to move molecules across a membrane against are gradient

What characteristic of water causes water to stick to the side of a test tube?

I need a claim, evidence, and reasoning ! will give brainlist

Answers

Answer:

The characteristic of water that makes this liquid stick to the side of a test tube is called capillarity (Claim).

Explanation:

Water (H₂O) is a polar molecule with the ability to generate van der Waals forces, which is explained by the 4 hydrogen bonds it forms to bind to other substances. The consequence of the forces of the molecular bonds are four properties of H₂O, including surface tension, cohesion, adhesion and capillarity.

- Claim: The characteristic of water that makes this liquid stick to the side of a test tube is called capillarity.

- Evidence: Cohesion and adhesion of water are properties that come from the forces of the molecular bonds of water, and whose effect is the ability of water to wet surfaces and adhere to a tube that contains it, the latter due to capillarity. Capillarity also allows water to rise through the roots and stems of plants, through their thin vascular ducts.

- Reasoning: cohesion in water depends on the force of attraction between H₂O molecules, adhesion is the capacity of H₂O molecules to join other different molecules and —together with surface tension— make H₂O molecules close to the walls of a glass tube adhere to it, which represents capillarity.

The effect of capillarity is more evident when the test tube is of a smaller diameter, although capillarity and adhesion to its walls always exist, and to a greater degree than any other substance.

Help please!
I know one of the answers is that the lower temperature means the reaction will happen slower, but what’s the second answer?

Answers

Answer with Explanation:

Hydrogen peroxide is considered "unstable," thus, storing it in the refrigerator provides two advantages:

1. It slows down thermal decomposition.

The rate of decomposition slows down when the temperature is lowered. It increases when the temperature rises.

2. It prevents photolytic decomposition.

Photolytic decomposition happens when hydrogen peroxide is exposed to sunlight or bright light. It therefore increases the rate of reaction. Therefore, hydrogen peroxide should be stored in a cool and dark place, such as the refrigerator.

what is genotype ?

hey fantasia ​

Answers

Answer:

a genotype is a type of gene that u can't see but phenotype is a type of gene difference that u can see by ur eyes

can i have brainliest if it helped

stay safe

Answer:

ham na jante hua ka batau

tik byy

if a person throws a wiffle ball and a tennis ball at the same speed , which object would travel with more kinetic energy

Answers

Answer:

Tennis ball

Explanation: Wiffle ball is lighter than the tennis ball. Heavier objects will have more kinetic energy than lighter objects. Therefore, the tennis ball is the correct answer. Hope this helps :)

What is the energy source which runs the electron transport chain?

Answers

Answer:

ATP

Explanation:

atp is the main source of energy for many cellular processes including muscle contraction and cell division.

If the Pacific plate is moving at a speed of 5 centimeters per year, how many kilometers will the Pacific plate travel in 1 million years?

Answers

Answer: 50 kilometers

Explanation:

From the question, we are informed that the Pacific plate is moving at a speed of 5 centimeters per year. The number of kilometers that the Pacific plate will travel in 1 million years would be calculated as:

= 5 × 1,000,000

= 5,000,000 centimeters

Since 100000 centimeters = 1 kilometer, we would convert 5,000,000 centimeters to kilometers. This will be:

= 5,000,000 / 100,000

= 50 kilometers

How do plants turn sunlight into energy?
This needs to have a chemical equation, reactants, and products.

Answers

Answer: Photosynthesis
The picture shows the chemical equation the reactants are before the arrow the product is after.
The yellow lines at the top is sunlight

You are watching the baseball World Series with your friends and you are amazed at how anyone can hit a fastball. You are arguing with your friends about which systems are most important in hitting the ball. Your friend said the nervous system is involved. Which statement most accurately provides evidence to help support your friend’s claim?

A.
The eyes, part of the nervous system, send messages directly to the arm muscles to swing the bat.

B.
The eye and arm, both part of the nervous system, tell the spinal cord to swing the bat.

C.
The brain and spinal cord, both part of the nervous system, direct the muscles in the arm to swing the bat.

D.
The brain, part of the nervous system, sends a message to the eyes to detect the ball and then the nerves swing the bat.

Answers

D is the correct answer

The correct option is D. The brain, part of the nervous system, sends a message to the eyes to detect the ball and then the nerves swing the bat.

What is brain?

The brain is a sophisticated organ that manages every bodily function as well as thought, memory, emotion, touch, motor skills, vision, respiration, temperature, and hunger. The central nervous system, or CNS, is made up of the spinal cord that emerges from the brain.

There are two distinct parts of the central nervous system: gray matter and white matter. Gray matter in the brain refers to the thicker, outer layer, and white matter to the thinner, inner layer beneath. This arrangement is reversed in the spinal cord, where the gray matter is located within and the white matter is on the outside.

Therefore, The correct option is D. The brain, part of the nervous system, sends a message to the eyes to detect the ball and then the nerves swing the bat.

To learn more about brain, refer to the link:

https://brainly.com/question/11950231

#SPJ2

Hello! I Need help with this. Please Help Make Sure you explain your answer i will be marking brainliest to the first person who has the right answer.....Please Help!!/

Answers

Answer:d

coach taught me that its about the mitts energy

Answer:

D. The catchers mitt will transform the balls kinetic energy to potential energy

Explanation:

I personally think it is D. Cause the kinetic energy(motion) is happening while the ball is move fast toward the catchers hand. Then when he catches it the ball stops moving and turns into potential energy(movement about to happen) cause the ball is not moving and the catcher has to return the ball back to who ever.

:D

A population of rabbits follows the typical pattern of inheritance and the law of dominance for fur color. B is the allele for brown fur and b is the allele for white fur. In a population of rabbits, 160 bunnies are born. How many bunnies should be white, according to the Punnett square? A) 40 B) 60 80 D) 100 ​

Answers

The answer would be a)40
After completing the punnet square you find that 1/4 of the bunnies will have white fur since white fur is recessive and would only be characterized if no dominant genes are present
1/4 of 160= 40

2. When you look at white light through a glass
prism, you see a rainbow of colors called a
a. spectrograph.
b. spectrum
c. parallax
d. light-year.​

Answers

Answer:

spectrum

Explanation:

I think its C) spectrum

Answer: the answer is a spectrum

Explanation:

Cuz it’s a spectrum

FIFTEEN POINTS!! What is the benefit of CAM photosynthesis?

Increases the rate of sugar produced by photosynthesis


Increases the efficiency of CO2 absorption in the daytime


Reduces the amount of water lost due to hot, daytime conditions


All of the above

Answers

Answer:

All of the above

Explanation:

CAM leaves the stomata closed during the day. They are most common in hot, arid environments. During the night, when their stomata are open, these plants take up CO2 and incorporate it into a variety of organic acids.

A 2. Which of the following are features that help scientists classify annelids into their respective classes? O presence of setae and tentacles presence of setae and parapodia presence of setae and septa presence of coelom and parapodia​

Answers

Answer:

presence of setae and parapodia​

Explanation:

Annelids are groups of organisms under the phylum "Annelida". They are organisms that possess the following characteristics or features: setae, parapodia, coelom, tentacles etc. However, via the possession of not of the setae and parapodia, annelids have been classified into four major classes viz: Polychaeta, Oligochaeta, Hiradinea and Archiannelida, on the basis of their setae and parapodia mainly.

- Polychaeta: possess numerous setae and parapodia

- Oligochaeta: few setae, no parapodia

- Hiradinea: No setae, no parapodia

- Archiannelida: No setae, no parapodia

Hence, the presence of setae and parapodia​ will enable the scientists classify annelids into their respective classes.

Answer:

presence of setae and parapodia

Explanation:

Scientists determine what class Annelids are categorized into based on whether or they have parapodia and/or setae.

Other Questions
Describe why people settled in the Balkan Peninsula by the A.D. 400s and500s. Find the slope of the line that contains (7, -4) and (3, -3). Of those released from Florida prisons what fraction end up back in prison within 3 years a third a halfa fourth two thirds How might the Nazis treatment of European Jews have affected everyone else? Hello , I really want to know basic things in Japanese such as ' hello ' or ' how are you ? ' you know simple things like that I'd like to know just different things so if you could just help me up with my learning in that language that'll be great . Thank you ! Choose the correct translation of the following sentence.Elle a d partir.A. she must have leftB. she left C. she was able to leave. D. she was leaving. 9. All of following would be part of a franchise branding EXCEPT... A.Creating a recognizable logo B. Having one font for all menus C. Interviewing staff for the business D.Using the same colors in all materials Will give brainliest to the first correct answer! Describe the factors influencing chemical bonds and the characteristics of an ionic and a covalent bond. please helpppppppppppp:$ Sarah and her friends ordered a pizza. Sarah ate 5 1 of the pizza. Her friend John ate 20% and her friend Jules ate half of the pizza. How much pizza is left over? Which phase determines the length of whole cell cycle? A. G1 phase B. G2 phase C. M phase D. S phase 30 points each answer Math After being rearranged and simplified, which of the following equations could be solved using the quadratic formula? Check all that apply.Choices are in picture. Please only real answers. If J is the centroid of cde, de=52, fc=15, he=14, find each missing measure plz help I'll give you some points The measured of angle C is ___ degrees, and the measure of angle D is ___ degrees Given your test grades; Test average 80, Homework 95, Class participation 90. Use thefollowing grading scale to figure out what you need to make on your final in order to get an A(89.5) in the class. (MAMDMN1.b)Grading SystemTest Average - 50%Final Exam Grade - 20%Homework - 20%Class Participation - 10%(5 Points)a. .75.5b. 84.5C.86.5O d. 107.5 Tim buys a torch and a battery. The torch costs 11 times as much as the battery. Tim pays with a 10 note and gets 4.84 change. How much did the battery cost? Two iron bolts of equal Mass one at a hundred see another at 55 Sierra place in the insulated cylinder assuming the heat capacity of the container is negligible what is the final temperature inside the container What is the complex conjugate of 7 + 8i ? Denis let go of a penny at the top of a well and the penny fell straight down to the bottom of the well the top of the well was 1 1/2 meters above ground . The bottom of the well was 11 meters below ground .what does -12 1/2 tell us Steam Workshop Downloader